Morpholino

MO3-sdc4

ID
ZDB-MRPHLNO-120425-8
Name
MO3-sdc4
Previous Names
  • MOsdc4 (1)
Target
Sequence
5' - TGAGGTAAACTTTCAACATCTTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sdc4
Expressed Gene Anatomy Figures
elavl3 Fig. 4 with image from Luo et al., 2016
gfap Fig. 3 with image from Luo et al., 2016
isl1a Fig. 4 with image from Luo et al., 2016
isl2a Fig. 4 with image from Luo et al., 2016
nes Fig. 2 with image from Luo et al., 2016
olig2 Fig. 3 with image,  Fig. 5 with image from Luo et al., 2016
slc1a3a Fig. 3 with image from Luo et al., 2016
Phenotype
Phenotype resulting from MO3-sdc4
Phenotype Fish Figures
CaP motoneuron morphology, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon decreased length, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO3-sdc4 Fig. 6 with image from Luo et al., 2016
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO3-sdc4 Fig. 5 from Lambaerts et al., 2012
forebrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
forebrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
hindbrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
midbrain elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
midbrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
neuronal stem cell nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
spinal cord elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
spinal cord gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
spinal cord olig2 expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image,  Fig. 5 with image from Luo et al., 2016
spinal cord dorsal region slc1a3a expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
spinal cord ventral region isl1a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
spinal cord ventral region isl2a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism isl2a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism slc1a3a expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism olig2 expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism nes expression increased amount, abnormal AB + MO3-sdc4 Fig. 2 with image from Luo et al., 2016
whole organism gfap expression increased amount, abnormal AB + MO3-sdc4 Fig. 3 with image from Luo et al., 2016
whole organism elavl3 expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
whole organism isl1a expression increased amount, abnormal AB + MO3-sdc4 Fig. 4 with image from Luo et al., 2016
Phenotype of all Fish created by or utilizing MO3-sdc4
Phenotype Fish Conditions Figures
hindbrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
spinal cord ventral region isl2a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
midbrain elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
whole organism isl2a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
whole organism nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
whole organism olig2 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
forebrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
spinal cord dorsal region slc1a3a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
midbrain ventricular zone gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO3-sdc4 standard conditions Fig. 5 from Lambaerts et al., 2012
whole organism isl1a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
spinal cord olig2 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image,  Fig. 5 with image from Luo et al., 2016
whole organism gfap expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
whole organism elavl3 expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
whole organism slc1a3a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 3 with image from Luo et al., 2016
forebrain ventricular zone nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
spinal cord ventral region isl1a expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 4 with image from Luo et al., 2016
neuronal stem cell nes expression increased amount, abnormal AB + MO3-sdc4 standard conditions Fig. 2 with image from Luo et al., 2016
CaP motoneuron morphology, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
CaP motoneuron axon decreased length, abnormal ml2Tg + MO3-sdc4 standard conditions Fig. 6 with image from Luo et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.