Morpholino

MO1-rbfox2

ID
ZDB-MRPHLNO-111205-3
Name
MO1-rbfox2
Previous Names
None
Target
Sequence
5' - TATAATGCTTTATATACCCCGAACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbfox2
No data available
Phenotype
Phenotype resulting from MO1-rbfox2
Phenotype of all Fish created by or utilizing MO1-rbfox2
Phenotype Fish Conditions Figures
skeletal muscle contraction decreased efficacy, abnormal AB + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
skeletal muscle decreased force, abnormal AB + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
whole organism decreased coiling, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions text only from Gallagher et al., 2011
skeletal muscle transverse plane structure, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 5 from Martin et al., 2015
myofibril assembly disrupted, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 6 with image from Gallagher et al., 2011
muscle myofibril undulate, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. S9 with image from Gallagher et al., 2011
locomotory behavior decreased occurrence, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions text only from Gallagher et al., 2011
whole organism paralysed, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions text only from Gallagher et al., 2011
skeletal muscle paralysed, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
muscle striated muscle thin filament disorganized, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 5 with image from Gallagher et al., 2011
skeletal muscle contraction decreased efficacy, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
skeletal muscle contraction decreased occurrence, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
muscle sarcomere decreased amount, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 6 with image from Gallagher et al., 2011
muscle myofibril disorganized, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 5 with imageFig. S9 with image from Gallagher et al., 2011
muscle sarcomere disorganized, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 6 with image from Gallagher et al., 2011
muscle Z disc misaligned with muscle Z disc, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 6 with image from Gallagher et al., 2011
skeletal muscle decreased force, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 6 from Martin et al., 2015
thigmotaxis disrupted, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions text only from Gallagher et al., 2011
skeletal muscle transverse plane shape, abnormal AB + MO1-rbfox1l + MO1-rbfox2 control Fig. 5 from Martin et al., 2015
muscle sarcoplasmic reticulum disorganized, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 6 with image from Gallagher et al., 2011
muscle refractivity, abnormal AB + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 4 with image from Gallagher et al., 2011
heart morphology, abnormal f1Tg + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 4 with image from Gallagher et al., 2011
myocardium non-functional, abnormal f1Tg + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 4 with image from Gallagher et al., 2011
ventricular cardiac muscle tissue morphogenesis disrupted, abnormal f1Tg + MO1-rbfox1l + MO1-rbfox2 standard conditions Fig. 4 with image from Gallagher et al., 2011
Citations