Morpholino

MO2-klf4

ID
ZDB-MRPHLNO-111014-2
Name
MO2-klf4
Previous Names
None
Target
Sequence
5' - CAAACTCAGTCGGAGGCTGCCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf4
Expressed Gene Anatomy Figures
atp1a1a.1 Fig 4 with image from Chen et al., 2019
atp6v1aa Fig 4 with image,  Fig. S13 from Chen et al., 2019
col1a1a Fig. S3 from Chen et al., 2019
dlc Fig 3 with image,  Fig. S1 from Chen et al., 2019
foxi3a Fig 3 with image from Chen et al., 2019
foxi3b Fig 3 with image from Chen et al., 2019
klf4 Fig. S4 from Chen et al., 2019
slc15a1b Fig. 3 with image from Li et al., 2011
tp63 Fig 5 with image,  Fig. S1 from Chen et al., 2019
Phenotype
Phenotype resulting from MO2-klf4
Phenotype Fish Figures
eye decreased size, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
intestine distended, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
otic vesicle decreased size, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
swim bladder non-functional, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
tectal ventricle increased size, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal AB + MO2-klf4 Fig. 2 with image from Li et al., 2011
Phenotype of all Fish created by or utilizing MO2-klf4
Phenotype Fish Conditions Figures
mid intestine goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
tectal ventricle increased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 4 with image from Li et al., 2011
liver hypoplastic, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
cell population proliferation increased rate, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 7 with image from Li et al., 2011
posterior intestine goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
eye decreased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine distended, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
swim bladder non-functional, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
otic vesicle decreased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine hypoplastic, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestinal bulb goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
goblet cell poorly differentiated, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
enteroendocrine cell differentiation disrupted, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 5 with image from Li et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
tectal ventricle increased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine distended, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
swim bladder non-functional, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
otic vesicle decreased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
eye decreased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 3 with image,  Fig. S1,  Fig. S4,  Fig. S13 from Chen et al., 2019
epidermis somatic stem cell decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S1 from Chen et al., 2019
extension vH ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 4 with image from Chen et al., 2019
keratinocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S1,  Fig. S3,  Fig. S4 from Chen et al., 2019
ball vH ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S5 from Chen et al., 2019
extension NaK ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 4 with image from Chen et al., 2019
ball NaK ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S5 from Chen et al., 2019
ectoderm stem cell proliferation decreased occurrence, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 5 with image from Chen et al., 2019
ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig. S13 from Chen et al., 2019
ectoderm cell population proliferation occurrence, ameliorated WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig 5 with image from Chen et al., 2019
ectoderm cell population proliferation occurrence, ameliorated WT + MO1-cdkn1a + MO1-klf4 + MO2-klf4 standard conditions Fig 5 with image from Chen et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.