Morpholino

MO6-cav1

ID
ZDB-MRPHLNO-100806-4
Name
MO6-cav1
Previous Names
  • cav-1b-MO (1)
Target
Sequence
5' - GCGAGTGAGCGTATTCCTGCGGTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-cav1
Expressed Gene Anatomy Figures
bmp2b Fig. 2 with image from Mo et al., 2010
chrd Fig. 2 with image from Mo et al., 2010
dharma Fig. 4 with image from Mo et al., 2010
dkk1b Fig. 4 with image from Mo et al., 2010
eve1 Fig. 2 with image from Mo et al., 2010
gata1a Fig. 2 with image from Mo et al., 2010
gsc Fig. 2 with image from Mo et al., 2010
il17rd Fig. 4 with image from Mo et al., 2010
ndr1 Fig. 4 with image from Mo et al., 2010
noto Fig. 4 with image from Mo et al., 2010
otx2b Fig. 4 with image from Mo et al., 2010
spry4 Fig. 4 with image from Mo et al., 2010
tbx16l Fig. 4 with image from Mo et al., 2010
ved Fig. 4 with image from Mo et al., 2010
vent Fig. 4 with image from Mo et al., 2010
wnt8a Fig. 4 with image from Mo et al., 2010
xbp1 Fig. 4 with image from Mo et al., 2010
Phenotype
Phenotype resulting from MO6-cav1
Phenotype Fish Figures
dorsal/ventral pattern formation disrupted, abnormal AB + MO6-cav1 Fig. 2 with image,  Fig. 4 with image from Mo et al., 2010
notochord deformed, abnormal AB + MO4-tp53 + MO6-cav1 Fig. 2 with image from Mo et al., 2010
post-vent region decreased length, abnormal AB + MO4-tp53 + MO6-cav1 Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO6-cav1 Fig. 2 with image from Mo et al., 2010
tail bud protruding, abnormal AB + MO6-cav1 Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO6-cav1 Fig. 2 with image from Mo et al., 2010
whole organism wholly dorsalized, abnormal AB + MO6-cav1 Fig. 2 with image from Mo et al., 2010
Phenotype of all Fish created by or utilizing MO6-cav1
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
somite deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
trunk curved, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
notochord deformed, abnormal AB + MO4-tp53 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
tail bud protruding, abnormal AB + MO5-cav1 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
whole organism wholly dorsalized, abnormal AB + MO5-cav1 + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
whole organism wholly dorsalized, abnormal AB + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
tail bud protruding, abnormal AB + MO6-cav1 standard conditions Fig. 2 with image from Mo et al., 2010
dorsal/ventral pattern formation disrupted, abnormal AB + MO6-cav1 standard conditions Fig. 2 with image,  Fig. 4 with image from Mo et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.