Morpholino

MO1-dync1h1

ID
ZDB-MRPHLNO-100726-3
Name
MO1-dync1h1
Previous Names
  • dync1h1 ATG MO (1)
Target
Sequence
5' - CGCCGCTGTCAGACATTTCCTACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dync1h1
Expressed Gene Anatomy Figures
dync1h1 Fig. 3 with image from Insinna et al., 2010
mbpa Fig. 1 with image from Langworthy et al., 2012
Phenotype
Phenotype resulting from MO1-dync1h1
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
embryonic retina morphogenesis in camera-type eye process quality, abnormal WT + MO1-dync1h1 Fig. 3 with image from Insinna et al., 2010
eye decreased size, abnormal WT + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
Fig. 2 with image from Yang et al., 2015
Fig. 3 with image from Insinna et al., 2010
eye photoreceptor cell Golgi apparatus mislocalised, abnormal WT + MO1-dync1h1 Fig. 10 with image from Insinna et al., 2010
eye photoreceptor cell nucleus circular, abnormal WT + MO1-dync1h1 Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-dync1h1 Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell synapse malformed, abnormal WT + MO1-dync1h1 Fig. 11 with image from Insinna et al., 2010
integument melanosome dispersed, abnormal WT + MO1-dync1h1 Figure 5 with image from Zhang et al., 2022
melanocyte distended, abnormal WT + MO1-dync1h1 Fig. 3 with image from Insinna et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 3 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 3 with image from Yang et al., 2015
pericardium edematous, abnormal TL + MO1-dync1h1 Fig. 5 with image from Dona et al., 2015
photoreceptor cell morphogenesis process quality, abnormal WT + MO1-dync1h1 Fig. 3 with image,  Fig. 8 with image,  Fig. 13 with image from Insinna et al., 2010
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
retinal cone cell organelle mislocalised, abnormal WT + MO1-dync1h1 Fig. 9 with image from Insinna et al., 2010
retinal cone cell photoreceptor outer segment malformed, abnormal WT + MO1-dync1h1 Fig. 9 with image from Insinna et al., 2010
retinal rod cell photoreceptor outer segment physical object quality, abnormal a125Tg + MO1-dync1h1 Fig. 13 with image from Insinna et al., 2010
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 Fig. 2 with image from Yang et al., 2015
Phenotype of all Fish created by or utilizing MO1-dync1h1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
eye decreased size, abnormal TL + MO1-dync1h1 control Fig. 5 with image from Dona et al., 2015
melanocyte distended, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
retinal cone cell organelle mislocalised, abnormal WT + MO1-dync1h1 standard conditions Fig. 9 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-dync1h1 standard conditions Fig. 8 with image from Insinna et al., 2010
retinal cone cell photoreceptor outer segment malformed, abnormal WT + MO1-dync1h1 standard conditions Fig. 9 with image from Insinna et al., 2010
photoreceptor cell morphogenesis process quality, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image,  Fig. 8 with image from Insinna et al., 2010
eye decreased size, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
integument melanosome dispersed, abnormal WT + MO1-dync1h1 control Figure 5 with image from Zhang et al., 2022
embryonic retina morphogenesis in camera-type eye process quality, abnormal WT + MO1-dync1h1 standard conditions Fig. 3 with image from Insinna et al., 2010
eye photoreceptor cell nucleus circular, abnormal WT + MO1-dync1h1 standard conditions Fig. 8 with image from Insinna et al., 2010
eye photoreceptor cell Golgi apparatus mislocalised, abnormal WT + MO1-dync1h1 standard conditions Fig. 10 with image from Insinna et al., 2010
eye photoreceptor cell synapse malformed, abnormal WT + MO1-dync1h1 standard conditions Fig. 11 with image from Insinna et al., 2010
oligodendrocyte cell division decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
brain decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
oligodendrocyte cell migration decreased process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 3 with image from Yang et al., 2015
pigmentation process quality, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
swim bladder absent, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
eye decreased size, abnormal WT + MO1-dync1h1 + MO4-tp53 standard conditions Fig. 2 with image from Yang et al., 2015
photoreceptor cell morphogenesis process quality, abnormal a125Tg + MO1-dync1h1 standard conditions Fig. 13 with image from Insinna et al., 2010
retinal rod cell photoreceptor outer segment physical object quality, abnormal a125Tg + MO1-dync1h1 standard conditions Fig. 13 with image from Insinna et al., 2010
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
whole organism anterior-posterior axis decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
integument melanosome dispersed, abnormal adcy3azf3713/zf3713; adcy5zf3715/zf3715 + MO1-dync1h1 control Figure 5 with image from Zhang et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.