Morpholino

MO1-yy1a

ID
ZDB-MRPHLNO-100311-2
Name
MO1-yy1a
Previous Names
  • YY1 MO (1)
Target
Sequence
5' - GTACAGTGTCTCGCCCGACGCCATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-yy1a
Expressed Gene Anatomy Figures
jmjd6 Fig. 5 with image from Shiu et al., 2016
nkx2.5 Fig. 6 with image from Shiu et al., 2016
pax2a Fig. 6 with image from Shiu et al., 2016
tp53 Fig. 2 with image from Shiu et al., 2016
yy1a Fig. 4 with image,  Fig. 7 with image from Shiu et al., 2016
Phenotype
Phenotype resulting from MO1-yy1a
Phenotype Fish Figures
apoptotic cell clearance disrupted, abnormal WT + MO1-yy1a Fig. 8 with image from Shiu et al., 2016
atrium nkx2.5 expression absent, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
atrium aplastic, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
blood circulation disrupted, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
brain jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a Fig. 5 with image from Shiu et al., 2016
brain yy1a expression decreased distribution, abnormal WT + MO1-yy1a Fig. 7 with image from Shiu et al., 2016
brain pax2a expression decreased distribution, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
brain decreased size, abnormal WT + MO1-yy1a Fig. 4 with image,  Fig. 7 with image from Shiu et al., 2016
brain morphology, abnormal WT + MO1-yy1a Fig. 8 with image from Shiu et al., 2016
brain development disrupted, abnormal WT + MO1-yy1a Fig. 7 with image,  Fig. 8 with image from Shiu et al., 2016
embryonic morphogenesis disrupted, abnormal WT + MO1-yy1a Fig. 4 with image,  Fig. 7 with image from Shiu et al., 2016
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-yy1a Fig. 3 with image from Shiu et al., 2016
eye yy1a expression decreased distribution, abnormal WT + MO1-yy1a Fig. 7 with image from Shiu et al., 2016
forebrain decreased size, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
hatching arrested, abnormal WT + MO1-yy1a Fig. 4 with image from Shiu et al., 2016
heart hypoplastic, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
heart increased length, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
heart morphology, abnormal WT + MO1-yy1a Fig. 8 with image from Shiu et al., 2016
heart nkx2.5 expression spatial pattern, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
heart tubular, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
heart development disrupted, abnormal WT + MO1-yy1a Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Shiu et al., 2016
hindbrain decreased size, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
midbrain decreased size, abnormal WT + MO1-yy1a Fig. 6 with image from Shiu et al., 2016
somite apoptotic, abnormal WT + MO1-yy1a Fig. 8 with image from Shiu et al., 2016
somite jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a Fig. 5 with image from Shiu et al., 2016
whole organism apoptotic, abnormal WT + MO1-yy1a Fig. 8 with image from Shiu et al., 2016
whole organism jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a Fig. 5 with image from Shiu et al., 2016
whole organism yy1a expression decreased distribution, abnormal WT + MO1-yy1a Fig. 4 with image from Shiu et al., 2016
whole organism tp53 expression increased amount, abnormal WT + MO1-yy1a Fig. 2 with image from Shiu et al., 2016
whole organism yy1a expression spatial pattern, abnormal WT + MO1-yy1a Fig. 4 with image from Shiu et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-yy1a Fig. 6 with image,  Fig. 7 with image from Shiu et al., 2016
whole organism apoptotic process increased occurrence, abnormal WT + MO1-yy1a Fig. 2 with image from Shiu et al., 2016
Phenotype of all Fish created by or utilizing MO1-yy1a
Phenotype Fish Conditions Figures
hindbrain decreased size, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
apoptotic cell clearance disrupted, abnormal WT + MO1-yy1a standard conditions Fig. 8 with image from Shiu et al., 2016
brain morphology, abnormal WT + MO1-yy1a standard conditions Fig. 8 with image from Shiu et al., 2016
heart tubular, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
brain pax2a expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
heart increased length, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
whole organism jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 5 with image from Shiu et al., 2016
somite jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 5 with image from Shiu et al., 2016
eye yy1a expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 7 with image from Shiu et al., 2016
whole organism yy1a expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image from Shiu et al., 2016
heart development disrupted, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Shiu et al., 2016
atrium nkx2.5 expression absent, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image,  Fig. 7 with image from Shiu et al., 2016
heart morphology, abnormal WT + MO1-yy1a standard conditions Fig. 8 with image from Shiu et al., 2016
brain decreased size, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image,  Fig. 7 with image from Shiu et al., 2016
heart nkx2.5 expression spatial pattern, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
midbrain decreased size, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
heart hypoplastic, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
hatching arrested, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image from Shiu et al., 2016
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-yy1a standard conditions Fig. 3 with image from Shiu et al., 2016
brain yy1a expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 7 with image from Shiu et al., 2016
embryonic morphogenesis disrupted, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image,  Fig. 7 with image from Shiu et al., 2016
somite apoptotic, abnormal WT + MO1-yy1a standard conditions Fig. 8 with image from Shiu et al., 2016
whole organism apoptotic, abnormal WT + MO1-yy1a standard conditions Fig. 8 with image from Shiu et al., 2016
brain development disrupted, abnormal WT + MO1-yy1a standard conditions Fig. 7 with image,  Fig. 8 with image from Shiu et al., 2016
blood circulation disrupted, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
whole organism yy1a expression spatial pattern, abnormal WT + MO1-yy1a standard conditions Fig. 4 with image from Shiu et al., 2016
whole organism apoptotic process increased occurrence, abnormal WT + MO1-yy1a standard conditions Fig. 2 with image from Shiu et al., 2016
forebrain decreased size, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
brain jmjd6 expression decreased distribution, abnormal WT + MO1-yy1a standard conditions Fig. 5 with image from Shiu et al., 2016
atrium aplastic, abnormal WT + MO1-yy1a standard conditions Fig. 6 with image from Shiu et al., 2016
whole organism tp53 expression increased amount, abnormal WT + MO1-yy1a standard conditions Fig. 2 with image from Shiu et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.