Morpholino

MO4-dll4

ID
ZDB-MRPHLNO-100205-5
Name
MO4-dll4
Previous Names
None
Target
Sequence
5' - TGATCTCTGATTGCTTACGTTCTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The dll4 MO targets the exon 4/intron 4 splice-donor site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-dll4
Expressed Gene Anatomy Figures
flt4 Fig. 5 with image from Hogan et al., 2009
hey2 Fig. 5 with image from Hogan et al., 2009
runx1 Fig. 6 with image from Bonkhofer et al., 2019
vegfc Fig. 5 with image from Hogan et al., 2009
vegfd Fig. 5 with image from Hogan et al., 2009
Phenotype
Phenotype resulting from MO4-dll4
Phenotype Fish Figures
angiogenic sprout increased length, abnormal bns157Tg + MO4-dll4 Figure 4 with image from Helker et al., 2020
blood vessel EGFP expression increased amount, abnormal bns157Tg + MO4-dll4 Figure 4 with image from Helker et al., 2020
blood vessel development disrupted, abnormal hu4624Tg + MO4-dll4 Fig. 4 with image from Hogan et al., 2009
cellular response to growth factor stimulus increased occurrence, abnormal hu4624Tg + MO4-dll4 Fig. 5 with image from Hogan et al., 2009
dorsal aorta has extra parts of type endothelial tip cell, abnormal hu4624Tg + MO4-dll4 Fig. 4 with image from Hogan et al., 2009
intersegmental artery decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 8 with image from Mauri et al., 2021
Fig. 4 with image from Weijts et al., 2013
intersegmental artery increased branchiness, abnormal y1Tg + MO4-dll4 Fig. 6 with image from Bower et al., 2017
Fig. 3 with image from Le Guen et al., 2014
intersegmental vein increased amount, abnormal hu5333Tg; hu7135Tg + MO4-dll4 Fig. 8 with image from Mauri et al., 2021
intersegmental vessel increased branchiness, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
posterior cardinal vein lacks parts or has fewer parts of type endothelial tip cell, abnormal hu4624Tg + MO4-dll4 Fig. 4 with image from Hogan et al., 2009
sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
sprouting angiogenesis growth quality of occurrent, abnormal y1Tg + MO4-dll4 Fig. 3 with image from Le Guen et al., 2014
thoracic duct absent, abnormal hu5333Tg; y1Tg + MO4-dll4 Fig. 4 with image from Weijts et al., 2013
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO4-dll4 Fig. 6 with image from Bonkhofer et al., 2019
Phenotype of all Fish created by or utilizing MO4-dll4
Phenotype Fish Conditions Figures
lymphangioblast cord absent, abnormal WT + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO4-dll4 standard conditions Fig. 6 with image from Bonkhofer et al., 2019
blood vessel EGFP expression increased amount, abnormal bns157Tg + MO4-dll4 standard conditions Figure 4 with image from Helker et al., 2020
angiogenic sprout increased length, abnormal bns157Tg + MO4-dll4 standard conditions Figure 4 with image from Helker et al., 2020
lymphangioblast cord absent, abnormal hu4453Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
cellular response to growth factor stimulus increased occurrence, abnormal hu4624Tg + MO4-dll4 standard conditions Fig. 5 with image from Hogan et al., 2009
dorsal aorta has extra parts of type endothelial tip cell, abnormal hu4624Tg + MO4-dll4 standard conditions Fig. 4 with image from Hogan et al., 2009
blood vessel development disrupted, abnormal hu4624Tg + MO4-dll4 standard conditions Fig. 4 with image from Hogan et al., 2009
posterior cardinal vein lacks parts or has fewer parts of type endothelial tip cell, abnormal hu4624Tg + MO4-dll4 standard conditions Fig. 4 with image from Hogan et al., 2009
thoracic duct wholeness, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1,  Fig. 4 from Geudens et al., 2010
lymphangiogenesis disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1,  Fig. 4 from Geudens et al., 2010
thoracic duct absent, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 1 from Geudens et al., 2010
branching involved in lymph vessel morphogenesis disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
lymphangiogenic sprout decreased amount, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
venous endothelial cell migration involved in lymph vessel development disrupted, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
thoracic duct hypotrophic, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
lymphangioblast cord absent, abnormal y1Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 4 from Geudens et al., 2010
sprouting angiogenesis growth quality of occurrent, abnormal y1Tg + MO4-dll4 standard conditions Fig. 3 with image from Le Guen et al., 2014
intersegmental artery increased branchiness, abnormal y1Tg + MO4-dll4 standard conditions Fig. 6 with image from Bower et al., 2017
Fig. 3 with image from Le Guen et al., 2014
intersegmental vein increased amount, abnormal hu5333Tg; hu7135Tg + MO4-dll4 standard conditions Fig. 8 with image from Mauri et al., 2021
intersegmental artery decreased amount, abnormal hu5333Tg; hu7135Tg + MO4-dll4 standard conditions Fig. 8 with image from Mauri et al., 2021
sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental artery decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental vessel increased branchiness, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
thoracic duct absent, abnormal hu5333Tg; y1Tg + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental vessel has extra parts of type endothelial cell, abnormal y7Tg + MO2-tmem230a + MO4-dll4 standard conditions Fig. 5 from Carra et al., 2018
intersegmental vessel endothelial cell increased amount, abnormal y7Tg + MO2-tmem230a + MO4-dll4 standard conditions Fig. 5 from Carra et al., 2018
trunk sprouting angiogenesis disrupted, abnormal aplnmu267/mu267; y1Tg + MO4-dll4 standard conditions Figure 4 with image from Helker et al., 2020
angiogenic sprout decreased length, abnormal aplnmu267/mu267; y1Tg + MO4-dll4 standard conditions Figure 4 with image from Helker et al., 2020
trunk sprouting angiogenesis decreased occurrence, abnormal aplnmu267/mu267; y1Tg + MO4-dll4 standard conditions Figure 4 with image from Helker et al., 2020
intersegmental artery absent, abnormal hu4624Tg; s916Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
intersegmental vessel has extra parts of type intersegmental vein, abnormal hu4624Tg; s916Tg + MO3-dll4 + MO4-dll4 standard conditions Fig. 2 from Geudens et al., 2010
intersegmental artery branchiness, ameliorated vegfchu5055/hu5055; y1Tg + MO4-dll4 standard conditions Fig. 6 with image from Bower et al., 2017
thoracic duct absent, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
sprouting angiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast cord lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental artery decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangioblast decreased amount, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
lymphangiogenesis disrupted, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental vessel increased branchiness, abnormal hu5333Tg; y1Tg + MO1-e2f7 + MO1-e2f8 + MO4-dll4 standard conditions Fig. 4 with image from Weijts et al., 2013
intersegmental artery branchiness, ameliorated vegfchu5055/hu5055; vegfduq9bh/uq9bh; y1Tg + MO4-dll4 standard conditions Fig. 6 with image from Bower et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.