Morpholino

MO4-nkx2.2a

ID
ZDB-MRPHLNO-080321-2
Name
MO4-nkx2.2a
Previous Names
  • nkx2.2a MO1
Target
Sequence
5' - CCGTCTTTGTGTTGGTCAACGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Start site morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nkx2.2a
Expressed Gene Anatomy Figures
foxa2 Fig. S1 from Kucenas et al., 2008
mbpa Fig. 6 from Kucenas et al., 2008
nkx2.2b Fig. S1 from Kucenas et al., 2008
plp1a Fig. 6 from Kucenas et al., 2008
sox10 Fig. 5,  Fig. 7 from Kucenas et al., 2008
Phenotype
Phenotype resulting from MO4-nkx2.2a
Phenotype Fish Figures
glial cell mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6,  Fig. S2 from Kucenas et al., 2008
glial cell bicellular tight junction absent, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. S2 from Kucenas et al., 2008
glial cell migration disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon decreased thickness, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon defasciculated, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
motor neuron axon guidance disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. 6 from Kucenas et al., 2008
myelin assembly disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) Fig. S2 from Kucenas et al., 2008
myelinating Schwann cell mislocalised, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) Fig. 7 from Kucenas et al., 2008
oligodendrocyte differentiation decreased frequency, abnormal AB + MO4-nkx2.2a Fig. 6 from Kucenas et al., 2008
Schwann cell development disrupted, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) Fig. 7 from Kucenas et al., 2008
spinal cord has extra parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a Fig. 5 from Kucenas et al., 2008
spinal cord has fewer parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a Fig. 5 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu12Tg + MO4-nkx2.2a Fig. 7,  Fig. 8 from Kucenas et al., 2008
spinal cord oligodendrocyte cell fate specification process quality, abnormal vu234Tg + MO4-nkx2.2a Fig. 8 from Kucenas et al., 2008
Phenotype of all Fish created by or utilizing MO4-nkx2.2a
Phenotype Fish Conditions Figures
oligodendrocyte differentiation decreased frequency, abnormal AB + MO4-nkx2.2a standard conditions Fig. 6 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu12Tg + MO4-nkx2.2a standard conditions Fig. 7 from Kucenas et al., 2008
spinal cord oligodendrocyte cell fate specification process quality, abnormal vu234Tg + MO4-nkx2.2a standard conditions Fig. 8 from Kucenas et al., 2008
spinal cord oligodendrocyte cell differentiation delayed, abnormal vu234Tg + MO4-nkx2.2a standard conditions Fig. 8 from Kucenas et al., 2008
spinal cord has extra parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a standard conditions Fig. 5 from Kucenas et al., 2008
spinal cord has fewer parts of type oligodendrocyte, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a standard conditions Fig. 5 from Kucenas et al., 2008
motor neuron mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
glial cell mislocalised, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6,  Fig. S2 from Kucenas et al., 2008
glial cell migration disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
glial cell bicellular tight junction absent, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. S2 from Kucenas et al., 2008
motor neuron axon guidance disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
motor neuron axon defasciculated, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
motor neuron axon decreased thickness, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. 6 from Kucenas et al., 2008
myelin assembly disrupted, abnormal vu17Tg; vu19Tg + MO4-nkx2.2a (AB) standard conditions Fig. S2 from Kucenas et al., 2008
Schwann cell development disrupted, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) standard conditions Fig. 7 from Kucenas et al., 2008
myelinating Schwann cell mislocalised, abnormal vu17Tg; vu234Tg + MO4-nkx2.2a (AB) standard conditions Fig. 7 from Kucenas et al., 2008
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-nkx2.9 + MO4-nkx2.2a standard conditions Fig. 3 with image from Yang et al., 2010
spinal cord interneuron cellular quality, abnormal WT + MO1-nkx2.9 + MO4-nkx2.2a standard conditions Fig. 3 with image from Yang et al., 2010
lateral floor plate GABAergic neuron absent, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 5 with image from Yang et al., 2010
spinal cord interneuron cellular quality, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 3 with image,  Fig. 7 with image from Yang et al., 2010
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 3 with image,  Fig. 7 with image,  Fig. 8 with image from Yang et al., 2010
lateral floor plate Kolmer-Agduhr neuron cellular quality, abnormal WT + MO1-nkx2.9 + MO2-nkx2.2b + MO4-nkx2.2a standard conditions Fig. 7 with image,  Fig. 8 with image from Yang et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.