Morpholino

MO1-neurod1

ID
ZDB-MRPHLNO-080317-1
Name
MO1-neurod1
Previous Names
None
Target
Sequence
5' - TGACTTCGTCATGTCGGAACTCTAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-neurod1
Phenotype
Phenotype resulting from MO1-neurod1
Phenotype Fish Figures
hair cell posterior macula decreased amount, abnormal s356tTg + MO1-neurod1 Fig. 7 from Sapède et al., 2012
head ccnd1 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head hes6 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head notch1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head dld expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head dla expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head ascl1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
head ccnb1 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
neuromast shape, abnormal WT + MO1-neurod1 Fig. 5 from Sarrazin et al., 2006
neuromast hair cell absent, abnormal WT + MO1-neurod1 Fig. 6 from Sarrazin et al., 2006
posterior lateral line development disrupted, abnormal WT + MO1-neurod1 Fig. 3 from Sarrazin et al., 2006
posterior lateral line neuromast decreased amount, abnormal WT + MO1-neurod1 Fig. 3text only from Sarrazin et al., 2006
retina cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 Fig. 5 from Taylor et al., 2015
retina central region notch1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retina central region her4.1 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retina central region ascl1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retina central region dld expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retina central region dla expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retina Notch signaling pathway increased occurrence, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-neurod1 Fig. 5 from Taylor et al., 2015
retinal cone cell decreased amount, abnormal AB + MO1-neurod1 Fig. 5 from Taylor et al., 2015
retinal inner nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 Fig. 5 from Taylor et al., 2015
Phenotype of all Fish created by or utilizing MO1-neurod1
Phenotype Fish Conditions Figures
retinal inner nuclear layer ascl1a expression amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
regenerating tissue retinal rod cell decreased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 9Fig. 12 from Taylor et al., 2015
head ascl1a expression decreased amount, abnormal AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
retinal inner nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer cell population proliferation occurrence, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
retinal inner nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue cell population proliferation increased occurrence, exacerbated AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 8 from Taylor et al., 2015
head dld expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
head ccnd1 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue retinal outer nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retinal outer nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue retinal inner nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
regenerating tissue retinal inner nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
regenerating tissue retinal cone cell decreased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 9Fig. 12 from Taylor et al., 2015
retinal outer nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 control Fig. 5 from Taylor et al., 2015
regenerating tissue retinal inner nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
head ascl1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal rod cell regeneration decreased occurrence, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 9 from Taylor et al., 2015
retina central region her4.1 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue retinal outer nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retinal inner nuclear layer her4.1 expression amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
regenerating tissue retinal inner nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retina cell population proliferation increased occurrence, exacerbated AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 8 from Taylor et al., 2015
retinal outer nuclear layer ascl1a expression amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
regenerating tissue retinal outer nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retina central region dld expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retina central region dla expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal cone cell zpr-1 labeling absent, abnormal AB + MO1-neurod1 control Fig. 5 from Taylor et al., 2015
retinal outer nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retina cell population proliferation increased occurrence, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
regenerating tissue retinal cone cell amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT, light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
retinal inner nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
retina central region notch1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue cell population proliferation increased occurrence, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT, light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
regenerating tissue retinal outer nuclear layer ascl1a expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retina cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
retina cell population proliferation increased occurrence, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT, light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
regenerating tissue retinal rod cell amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT, light ablation: photoreceptor cell Fig. 12 from Taylor et al., 2015
retinal outer nuclear layer dla expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal outer nuclear layer her4.1 expression amount, ameliorated AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
retina central region ascl1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retina Notch signaling pathway increased occurrence, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer her4.1 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
regenerating tissue retinal inner nuclear layer dld expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
retinal cone cell decreased amount, abnormal AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
retinal cone cell decreased amount, abnormal AB + MO1-neurod1 control Fig. 5 from Taylor et al., 2015
head notch1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal inner nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
head ccnb1 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
head her4.1 expression decreased amount, abnormal AB + MO1-neurod1 chemical treatment by environment: DAPT Fig. 5 from Taylor et al., 2015
retina cell population proliferation increased occurrence, abnormal AB + MO1-neurod1 control Fig. 5 from Taylor et al., 2015
head dla expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
retinal cone cell regeneration decreased occurrence, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 9 from Taylor et al., 2015
regenerating tissue retinal outer nuclear layer notch1a expression increased amount, abnormal AB + MO1-neurod1 light ablation: photoreceptor cell Fig. 11 from Taylor et al., 2015
head hes6 expression increased amount, abnormal AB + MO1-neurod1 standard conditions Fig. 2 from Taylor et al., 2015
neuromast hair cell absent, abnormal WT + MO1-neurod1 standard conditions Fig. 6 from Sarrazin et al., 2006
posterior lateral line neuromast decreased amount, abnormal WT + MO1-neurod1 standard conditions Fig. 3text only from Sarrazin et al., 2006
posterior lateral line development disrupted, abnormal WT + MO1-neurod1 standard conditions Fig. 3 from Sarrazin et al., 2006
neuromast shape, abnormal WT + MO1-neurod1 standard conditions Fig. 5 from Sarrazin et al., 2006
hair cell posterior macula decreased amount, abnormal s356tTg + MO1-neurod1 standard conditions Fig. 7 from Sapède et al., 2012
Citations