Morpholino
MO4-tfap2a
- ID
- ZDB-MRPHLNO-080226-1
- Name
- MO4-tfap2a
- Previous Names
-
- ap2a E2I2 (1)
- Target
- Sequence
-
5' - AGCTTTTCTTCTTACCTGAACATCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice blocking morpholino designed against the exon 2 - intron 2 splice site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tfap2a
Expressed Gene | Anatomy | Figures |
---|---|---|
clcnk |
Fig. 3
from Chambers et al., 2019 |
|
fgf3 |
Fig. 6
from Kantarci et al., 2015 |
|
fgf8a |
Fig. 6
from Kantarci et al., 2015 |
|
fgf10a |
Fig. 6
from Kantarci et al., 2015 |
|
fscn1a |
Fig. 1
from Boer et al., 2015 |
|
irx1a |
Fig. 6
from Chambers et al., 2019 |
|
irx3b |
Fig. 6
from Chambers et al., 2019 |
|
pax5 |
Fig. 5
from Kantarci et al., 2015 |
|
pou3f3b |
Fig. 5
from Kantarci et al., 2015 |
|
slc12a1 |
Fig. 3
from Chambers et al., 2019 |
|
slc12a3 |
Fig. 3
from Chambers et al., 2019 |
Phenotype
Phenotype resulting from MO4-tfap2a
No data available
Phenotype of all Fish created by or utilizing MO4-tfap2a
No data available
Citations