Morpholino

MO3-cyp26b1

ID
ZDB-MRPHLNO-080104-1
Name
MO3-cyp26b1
Previous Names
  • cyp26b1 MO (1)
  • Cyp26B1-splice-MO (1)
Target
Sequence
5' - CTTACTCGCGCTTAACCTGAAAGAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cyp26b1
Phenotype
Phenotype resulting from MO3-cyp26b1
Phenotype Fish Figures
epibranchial ganglion disorganized, abnormal rw0Tg + MO3-cyp26b1 Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion neuron decreased amount, abnormal rw0Tg + MO3-cyp26b1 Fig. 4 from Reijntjes et al., 2007
eye decreased size, abnormal WT + MO3-cyp26b1 Fig. 5 from Reijntjes et al., 2007
head decreased size, abnormal WT + MO3-cyp26b1 Fig. 2Fig. 5 from Reijntjes et al., 2007
hindbrain decreased size, abnormal rw0Tg + MO3-cyp26b1 Fig. 4 from Reijntjes et al., 2007
hindbrain morphology, abnormal WT + MO3-cyp26b1 Fig. 3 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal WT + MO3-cyp26b1 Fig. 3Fig. 4 from Reijntjes et al., 2007
mandibular arch skeleton malformed, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
Meckel's cartilage aplastic, abnormal WT + MO3-cyp26b1 Fig. 5 from Reijntjes et al., 2007
mouth decreased size, abnormal WT + MO3-cyp26b1 Fig. 5 from Reijntjes et al., 2007
neurocranium malformed, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
optic cup decreased size, abnormal WT + MO3-cyp26b1 Fig. 2 from Reijntjes et al., 2007
otic vesicle decreased size, abnormal WT + MO3-cyp26b1 Fig. 2 from Reijntjes et al., 2007
palatoquadrate cartilage aplastic, abnormal WT + MO3-cyp26b1 Fig. 5 from Reijntjes et al., 2007
pharyngeal arch aplastic, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
pharyngeal arch malformed, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
pharyngeal arch 3-7 malformed, abnormal WT + MO3-cyp26b1 Fig. 6 from Reijntjes et al., 2007
rhombomere 3 decreased width, abnormal WT + MO3-cyp26b1 Fig. 3 from Reijntjes et al., 2007
rhombomere 4 decreased size, abnormal WT + MO3-cyp26b1 Fig. 3 from Reijntjes et al., 2007
rhombomere 5 decreased width, abnormal WT + MO3-cyp26b1 Fig. 3 from Reijntjes et al., 2007
trabecula cranii aplastic, abnormal WT + MO3-cyp26b1 Fig. 5 from Reijntjes et al., 2007
Phenotype of all Fish created by or utilizing MO3-cyp26b1
Phenotype Fish Conditions Figures
pharyngeal arch 3-7 aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
rhombomere 5 decreased width, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
hindbrain morphology, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
palatoquadrate cartilage aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
trabecula cranii aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
rhombomere 4 decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
pharyngeal arch malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
mandibular arch skeleton malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
eye decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
pharyngeal arch 3-7 malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
neurocranium malformed, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
rhombomere 3 decreased width, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
mouth decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
optic cup decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2 from Reijntjes et al., 2007
pharyngeal arch aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 6 from Reijntjes et al., 2007
head decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2Fig. 5 from Reijntjes et al., 2007
Meckel's cartilage aplastic, abnormal WT + MO3-cyp26b1 standard conditions Fig. 5 from Reijntjes et al., 2007
otic vesicle decreased size, abnormal WT + MO3-cyp26b1 standard conditions Fig. 2 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal WT + MO3-cyp26b1 standard conditions Fig. 3 from Reijntjes et al., 2007
hindbrain development disrupted, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion neuron decreased amount, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
hindbrain decreased size, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
epibranchial ganglion disorganized, abnormal rw0Tg + MO3-cyp26b1 standard conditions Fig. 4 from Reijntjes et al., 2007
Citations