Morpholino

MO3-irx1a

ID
ZDB-MRPHLNO-070613-1
Name
MO3-irx1a
Previous Names
  • irx1aATGMO (1)
Target
Sequence
5' - GGAAGACATCTCCTCCGCCACGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-irx1a
Expressed Gene Anatomy Figures
atoh7 Fig. 4 with image from Cheng et al., 2006
isl1a Fig. 4 with image,  Fig. 5 with image from Cheng et al., 2006
pax6a Fig. 2 with image from Cheng et al., 2006
rx1 Fig. 2 with image from Cheng et al., 2006
Phenotype
Phenotype resulting from MO3-irx1a
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
cell death increased rate, abnormal WT + MO3-irx1a Fig. 3 with image from Cheng et al., 2006
cell population proliferation increased rate, abnormal WT + MO3-irx1a Fig. 3 with image from Cheng et al., 2006
cranial nerve II malformed, abnormal WT + MO3-irx1a Fig. 4 with image from Cheng et al., 2006
eye decreased size, abnormal WT + MO3-irx1a Fig. 2 with image from Cheng et al., 2006
eye photoreceptor cell differentiation disrupted, abnormal WT + MO3-irx1a Fig. 4 with image from Cheng et al., 2006
melanocyte melanosome increased distribution, abnormal WT + MO3-irx1a Fig. 2 with image from Cheng et al., 2006
Muller cell absent, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
neuron differentiation disrupted, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retina malformed, abnormal WT + MO3-irx1a Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Cheng et al., 2006
retina morphology, abnormal sb28Tg + MO3-irx1a Fig. 6 with image from Cheng et al., 2006
retina undifferentiated, abnormal WT + MO3-irx1a Fig. 2 with image from Cheng et al., 2006
retina neuron decreased amount, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retina development in camera-type eye disrupted, abnormal WT + MO3-irx1a Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Cheng et al., 2006
retina layer formation arrested, abnormal WT + MO3-irx1a Fig. 2 with image from Cheng et al., 2006
retinal bipolar neuron decreased amount, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retinal cone cell decreased amount, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO3-irx1a Fig. 4 with image from Cheng et al., 2006
retinal inner nuclear layer malformed, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retinal inner nuclear layer neuron decreased amount, abnormal WT + MO3-irx1a Fig. S1 with image from Cheng et al., 2006
retinal outer nuclear layer malformed, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
retinal rod cell decreased amount, abnormal WT + MO3-irx1a Fig. 5 with image from Cheng et al., 2006
whole organism increased pigmentation, abnormal WT + MO3-irx1a Fig. 2 with image from Cheng et al., 2006
Phenotype of all Fish created by or utilizing MO3-irx1a
Phenotype Fish Conditions Figures
hindbrain serotonergic neuron decreased amount, abnormal WT + MO2-irx1a + MO3-irx1a standard conditions Fig. 3 with image from Cheng et al., 2007
hindbrain antero-ventral region apoptotic, abnormal WT + MO2-irx1a + MO3-irx1a standard conditions Fig. 3 with image from Cheng et al., 2007
whole organism increased pigmentation, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image from Cheng et al., 2006
retinal bipolar neuron decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
melanocyte melanosome increased distribution, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image from Cheng et al., 2006
retina malformed, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Cheng et al., 2006
cranial nerve II malformed, abnormal WT + MO3-irx1a standard conditions Fig. 4 with image from Cheng et al., 2006
cell population proliferation increased rate, abnormal WT + MO3-irx1a standard conditions Fig. 3 with image from Cheng et al., 2006
retinal outer nuclear layer malformed, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retinal inner nuclear layer neuron decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. S1 with image from Cheng et al., 2006
amacrine cell decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retinal inner nuclear layer malformed, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retina undifferentiated, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image from Cheng et al., 2006
Muller cell absent, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
neuron differentiation disrupted, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
cell death increased rate, abnormal WT + MO3-irx1a standard conditions Fig. 3 with image from Cheng et al., 2006
eye photoreceptor cell differentiation disrupted, abnormal WT + MO3-irx1a standard conditions Fig. 4 with image from Cheng et al., 2006
retina development in camera-type eye disrupted, abnormal WT + MO3-irx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Cheng et al., 2006
retinal ganglion cell decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 4 with image from Cheng et al., 2006
retinal cone cell decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retina layer formation arrested, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image from Cheng et al., 2006
eye decreased size, abnormal WT + MO3-irx1a standard conditions Fig. 2 with image from Cheng et al., 2006
retinal rod cell decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retina neuron decreased amount, abnormal WT + MO3-irx1a standard conditions Fig. 5 with image from Cheng et al., 2006
retina morphology, abnormal sb28Tg + MO3-irx1a standard conditions Fig. 6 with image from Cheng et al., 2006
retina development in camera-type eye disrupted, abnormal sb28Tg + MO3-irx1a standard conditions Fig. 6 with image from Cheng et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.