Morpholino

MO1-tcf7l1a

ID
ZDB-MRPHLNO-060705-5
Name
MO1-tcf7l1a
Previous Names
  • hdl MO (1)
  • tcf3a Mo (1)
Target
Sequence
5' - CTCCGTTTAACTGAGGCATGTTGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1a
Expressed Gene Anatomy Figures
fabp2 Fig. 6 with image from Faro et al., 2009
fabp10a Fig. 6 with image from Faro et al., 2009
pax2a Fig. 7 from Cavodeassi et al., 2005
prss1 Fig. 6 with image from Faro et al., 2009
rx3 Fig. 7 from Cavodeassi et al., 2005
wnt1 Fig. 1 from Domené et al., 2008
Phenotype
Phenotype resulting from MO1-tcf7l1a
Phenotype Fish Figures
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
axial mesodermal cell fate specification increased occurrence, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a Figure 2 with image from Johansson et al., 2019
axis distended, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a Figure 2 with image from Johansson et al., 2019
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
eye aplastic, abnormal AB + MO1-tcf7l1a Fig. 1 from Domené et al., 2008
Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
eye decreased size, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye hypoplastic, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
head malformed, abnormal WT + MO1-tcf7l1a Fig. S1 with image from Faro et al., 2009
head anterior region truncated, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
head morphogenesis disrupted, abnormal WT + MO1-tcf7l1a Fig. S1 with image from Faro et al., 2009
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
telencephalon aplastic, abnormal WT + MO1-tcf7l1a Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
telencephalon morphology, abnormal WT + MO1-tcf7l1a Fig 3 with image from He et al., 2020
Phenotype of all Fish created by or utilizing MO1-tcf7l1a
Phenotype Fish Conditions Figures
axis distended, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a control Figure 2 with image from Johansson et al., 2019
axial mesodermal cell fate specification increased occurrence, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a control Figure 2 with image from Johansson et al., 2019
eye aplastic, abnormal AB + MO1-tcf7l1a standard conditions Fig. 1 from Domené et al., 2008
head anterior region truncated, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye hypoplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
telencephalon morphology, abnormal WT + MO1-tcf7l1a standard conditions Fig 3 with image from He et al., 2020
head morphogenesis disrupted, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
eye aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
eye decreased size, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head malformed, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
telencephalon aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
hepatocyte differentiation disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
exocrine pancreas development disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
head absent, abnormal WT + MO1-nanog + MO1-tcf7l1a standard conditions Fig 3 with image from He et al., 2020
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
exocrine pancreas development disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.