Morpholino

MO1-tcf7l1a

ID
ZDB-MRPHLNO-060705-5
Name
MO1-tcf7l1a
Previous Names
  • hdl MO (1)
  • tcf3a Mo (1)
Target
Sequence
5' - CTCCGTTTAACTGAGGCATGTTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1a
Phenotype
Phenotype resulting from MO1-tcf7l1a
Phenotype Fish Figures
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
axial mesodermal cell fate specification increased occurrence, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a Figure 2 with image from Johansson et al., 2019
axis distended, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a Figure 2 with image from Johansson et al., 2019
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
eye aplastic, abnormal AB + MO1-tcf7l1a Fig. 1 from Domené et al., 2008
Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
eye decreased size, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye hypoplastic, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
head malformed, abnormal WT + MO1-tcf7l1a Fig. S1 with image from Faro et al., 2009
head anterior region truncated, abnormal WT + MO1-tcf7l1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
head morphogenesis disrupted, abnormal WT + MO1-tcf7l1a Fig. S1 with image from Faro et al., 2009
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 Fig. 1 with image from Sorrell et al., 2013
telencephalon aplastic, abnormal WT + MO1-tcf7l1a Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
telencephalon morphology, abnormal WT + MO1-tcf7l1a Fig 3 with image from He et al., 2020
Phenotype of all Fish created by or utilizing MO1-tcf7l1a
Phenotype Fish Conditions Figures
axis distended, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a control Figure 2 with image from Johansson et al., 2019
axial mesodermal cell fate specification increased occurrence, abnormal ml1Tg/ml1Tg + MO1-tcf7l1a control Figure 2 with image from Johansson et al., 2019
eye aplastic, abnormal AB + MO1-tcf7l1a standard conditions Fig. 1 from Domené et al., 2008
head anterior region truncated, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye hypoplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
telencephalon morphology, abnormal WT + MO1-tcf7l1a standard conditions Fig 3 with image from He et al., 2020
eye aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
head morphogenesis disrupted, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
eye decreased size, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head malformed, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
telencephalon aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
hepatocyte differentiation disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
exocrine pancreas development disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
head absent, abnormal WT + MO1-nanog + MO1-tcf7l1a standard conditions Fig 3 with image from He et al., 2020
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
exocrine pancreas development disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
Citations