Morpholino
MO2-ctnnb1
- ID
- ZDB-MRPHLNO-060414-1
- Name
- MO2-ctnnb1
- Previous Names
-
- b-catenin-1 MO1 (1)
- Target
- Sequence
-
5' - CTGGGTAGCCATGATTTTCTCACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ctnnb1
Expressed Gene | Anatomy | Figures |
---|---|---|
chrd |
Fig. 2
from Varga et al., 2007 Fig. 7 from Bellipanni et al., 2006 |
|
dharma |
|
Fig. 5 ,
Fig. 7
from Bellipanni et al., 2006 |
egr2b |
Fig. 6
from Bellipanni et al., 2006 |
|
emx1 |
Fig. 6
from Bellipanni et al., 2006 |
|
gsc |
Fig. 7
from Bellipanni et al., 2006 |
|
hoxb6b |
Fig. 6
from Bellipanni et al., 2006 |
|
isl1a |
Fig. 6
from Bellipanni et al., 2006 |
|
myod1 |
Fig. 6
from Bellipanni et al., 2006 |
|
ndr1 |
Fig. 5 ,
Fig. 7
from Bellipanni et al., 2006 |
|
nog1 |
|
Fig. 2
from Varga et al., 2007 |
Phenotype
Phenotype resulting from MO2-ctnnb1
Phenotype of all Fish created by or utilizing MO2-ctnnb1
Citations