Morpholino

MO1-cnpy1

ID
ZDB-MRPHLNO-060315-6
Name
MO1-cnpy1
Previous Names
None
Target
Sequence
5' - ATGGTGACATGCTGGTCTCCTGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cnpy1
Expressed Gene Anatomy Figures
cdh1 Fig. 5 with image from Matsui et al., 2011
dand5 Fig. S6 with image from Matsui et al., 2011
en2a Fig. 2 from Hirate et al., 2006
fgf8a Fig. 2 from Hirate et al., 2006
fgfr1a Fig. S4 from Hirate et al., 2006
fgfr2 Fig. S4 from Hirate et al., 2006
fgfr3 Fig. S4 from Hirate et al., 2006
fgfr4 Fig. S4 from Hirate et al., 2006
il17rd Fig. 2 from Hirate et al., 2006
myl7 Fig. 2 with image from Matsui et al., 2011
pax2a Fig. 2 from Hirate et al., 2006
sox32 Fig. 1 with image,  Fig. 5 with image from Matsui et al., 2011
spaw Fig. S6 with image from Matsui et al., 2011
tbx16 Fig. 5 with image from Matsui et al., 2011
wnt1 Fig. 2 from Hirate et al., 2006
Phenotype
Phenotype resulting from MO1-cnpy1
Phenotype Fish Figures
cell-cell adhesion mediated by cadherin decreased process quality, abnormal WT + MO1-cnpy1 Fig. 5 with image from Matsui et al., 2011
cilium assembly decreased process quality, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
determination of left/right symmetry decreased process quality, abnormal WT + MO1-cnpy1 Fig. S6 with image from Matsui et al., 2011
endodermal cell mislocalised, abnormal WT + MO1-cnpy1 Fig. 1 with image from Matsui et al., 2011
fibroblast growth factor receptor signaling pathway decreased process quality, abnormal ha01Tg + MO1-cnpy1 Fig. 1 with image from Matsui et al., 2011
forerunner cell group distributed, abnormal WT + MO1-cnpy1 Fig. 1 with image,  Fig. 5 with image from Matsui et al., 2011
heart inverted, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
heart position, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
heart looping decreased process quality, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
Kupffer's vesicle physical object quality, abnormal WT + MO1-cnpy1 Fig. S6 with image from Matsui et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-cnpy1 Fig. 2 with image from Matsui et al., 2011
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-cnpy1 Fig. 2 with image,  Fig. S6 with image from Matsui et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-cnpy1 Fig. S6 with image from Matsui et al., 2011
Phenotype of all Fish created by or utilizing MO1-cnpy1
Phenotype Fish Conditions Figures
heart looping decreased process quality, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
determination of left/right symmetry decreased process quality, abnormal WT + MO1-cnpy1 standard conditions Fig. S6 with image from Matsui et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-cnpy1 standard conditions Fig. S6 with image from Matsui et al., 2011
Kupffer's vesicle physical object quality, abnormal WT + MO1-cnpy1 standard conditions Fig. S6 with image from Matsui et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
cell-cell adhesion mediated by cadherin decreased process quality, abnormal WT + MO1-cnpy1 standard conditions Fig. 5 with image from Matsui et al., 2011
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image,  Fig. S6 with image from Matsui et al., 2011
heart position, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
forerunner cell group distributed, abnormal WT + MO1-cnpy1 standard conditions Fig. 1 with image,  Fig. 5 with image from Matsui et al., 2011
endodermal cell mislocalised, abnormal WT + MO1-cnpy1 standard conditions Fig. 1 with image from Matsui et al., 2011
cilium assembly decreased process quality, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
heart inverted, abnormal WT + MO1-cnpy1 standard conditions Fig. 2 with image from Matsui et al., 2011
fibroblast growth factor receptor signaling pathway decreased process quality, abnormal ha01Tg + MO1-cnpy1 standard conditions Fig. 1 with image from Matsui et al., 2011
forerunner cell group distributed, abnormal ha01Tg + MO1-cnpy1 standard conditions Fig. 1 with image from Matsui et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.