Morpholino
MO2-wnt5b
- ID
- ZDB-MRPHLNO-051207-1
- Name
- MO2-wnt5b
- Previous Names
- None
- Target
- Sequence
-
5' - TGTTTATTTCCTCACCATTCTTCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 3' end of the exon-intron junction of exon 3. Robu et al. report that it is the splice-site–exon 6 splice acceptor (exon 5–6 junction)that is targeted.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt5b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| cdkn1a |
Fig. 8 
from Robu et al., 2007 |
|
| cp |
Fig. 6
from Kim et al., 2005 |
|
| cpa5 |
Fig. 6
from Kim et al., 2005 |
|
| foxa3 |
Fig. 4
from Kim et al., 2005 |
|
| gata6 |
Fig. 4
from Kim et al., 2005 |
|
| gcga |
Fig. 5
from Kim et al., 2005 |
|
| ins |
Fig. 3 ,
Fig. 6
from Kim et al., 2005 |
|
| isl1a |
Fig. 5
from Kim et al., 2005 |
|
| mixl1 |
Fig. 4
from Kim et al., 2005 |
|
| pdx1 |
Fig. 6
from Kim et al., 2005 |
|
| sox17 |
Fig. 4
from Kim et al., 2005 |
|
| spon1b |
Fig. 5
from Kim et al., 2005 |
|
| sst2 |
Fig. 5
from Kim et al., 2005 |
|
| tp53 |
Fig. 9
from Robu et al., 2007 |
|
| wnt5b |
|
Fig. 1
from Robu et al., 2007 |
Phenotype
Phenotype resulting from MO2-wnt5b
No data available
Phenotype of all Fish created by or utilizing MO2-wnt5b
No data available
Citations