Morpholino

MO1-ptgs1

ID
ZDB-MRPHLNO-050722-3
Name
MO1-ptgs1
Previous Names
  • cox1-MO (1)
  • MORPH1203 (1)
  • zCOX-1-A (1)
Target
Sequence
5' - TCAGCAAAAAGTTACACTCTCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed against translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptgs1
Expressed Gene Anatomy Figures
cimap1b Fig. 4 with image from Chambers et al., 2020
Fig. 1 with image,  Fig. 3 from Marra et al., 2019
gata1a Fig. 4 from Yeh et al., 2009
jag2b Fig. 2 from Marra et al., 2019
mpx Fig. 4 from Yeh et al., 2009
myl7 Fig. 5 from Jin et al., 2014
pax2a Fig. 2 from Marra et al., 2019
Fig. 7 with image from Cha et al., 2005
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
trpm7 Fig. 3 from Marra et al., 2019
Phenotype
Phenotype resulting from MO1-ptgs1
Phenotype Fish Figures
brain hydrocephalic, abnormal TU + MO1-ptgs1 Fig. S3 from Marra et al., 2019
Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-ptgs1 Fig. 5 with image from Grosser et al., 2002
heart bilateral symmetry, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
pericardium edematous, abnormal TU + MO1-ptgs1 Fig. S3 from Marra et al., 2019
post-vent region curved ventral, abnormal WT + MO1-ptgs1 Fig. 5 from Jin et al., 2014
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptgs1 Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 2 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 1 with image from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 Fig. 1 with image,  Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 Fig. 4 from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 Fig. 3 from Marra et al., 2019
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ptgs1 Fig. 4 with image from Chambers et al., 2020
trunk curved ventral, abnormal TU + MO1-ptgs1 Fig. 4 with image from Chambers et al., 2020
Fig. 5 from Jin et al., 2014
whole organism viability, abnormal AB + MO1-ptgs1 Fig. 5 with image from Grosser et al., 2002
Phenotype of all Fish created by or utilizing MO1-ptgs1
Phenotype Fish Conditions Figures
whole organism viability, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-ptgs1 standard conditions Fig. 5 with image from Grosser et al., 2002
pronephric distal late tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 2 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 3 from Marra et al., 2019
pronephric distal late tubule decreased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 control Fig. 4 from Marra et al., 2019
trunk curved ventral, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 control Fig. 3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs1 chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs1 control Fig. S3 from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 control Fig. 1 with image,  Fig. 2 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs1 control Fig. S3 from Marra et al., 2019
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 control Fig. 1 with image from Marra et al., 2019
pronephric distal early tubule increased size, abnormal TU + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule size, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated TU + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
post-vent region curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
brain ventricular system edematous, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
brain hydrocephalic, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
otic vesicle has extra parts of type otolith, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart bilateral symmetry, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
trunk curved ventral, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
heart looping process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
lateral crista has fewer parts of type lateral crista kinocilium, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
Kupffer's vesicle has fewer parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-ptgs1 chemical treatment: prostaglandin E2 Fig. 5 from Jin et al., 2014
cilium assembly decreased process quality, abnormal WT + MO1-ptgs1 standard conditions Fig. 5 from Jin et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptgs1 + MO2-ptgs1 standard conditions Fig. S1 from North et al., 2007
exocrine pancreas decreased size, abnormal WT + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptgs1 + MO2-ptgs1 control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptgs1 + MO2-ptgs1 chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
pronephros has fewer parts of type ciliated epithelial cell ciliary basal body, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium decreased length, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros has number of pronephros multi-ciliated epithelial cell, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
trunk curvature, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
trunk curved ventral, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly process quality, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephros cilium assembly decreased process quality, exacerbated TU + MO1-ppargc1a + MO1-ptgs1 standard conditions Fig. 4 with image from Chambers et al., 2020
pronephros cilium length, ameliorated TU + MO1-ppargc1a + MO1-ptgs1 chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Chambers et al., 2020
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 4 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, exacerbated TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
brain ventricular system edematous, abnormal WT + MO1-ptgs1 + MO2-ptgs2a standard conditions Fig. 5 from Jin et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.