Morpholino

MO3-fgf8a

ID
ZDB-MRPHLNO-050714-1
Name
MO3-fgf8a
Previous Names
  • fgf8 MO (1)
  • MO3-fgf8 (1)
Target
Sequence
5' - GAGTCTCATGTTTATAGCCTCAGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fgf8a
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 from Li et al., 2015
dlc Fig. 6 from Li et al., 2015
fgf4 Fig. 6 with image from Yamauchi et al., 2009
fgf16 Fig. 5 from Nomura et al., 2006
fgf22 Fig. 8 with image from Miyake et al., 2013
gata1a Fig. 8 with image from Warga et al., 2013
ins Fig. 3 from Song et al., 2007
meox1 Fig. 4 with image from Groves et al., 2005
myf5 Fig. 3 with image from Groves et al., 2005
mylpfa Fig. 2 with image from Groves et al., 2005
myod1 Fig. 3 with image from Groves et al., 2005
myog Fig. 3 with image from Groves et al., 2005
nkx2.5 Fig. 1 from Araki et al., 2001
pax2a Fig. 8 with image from Warga et al., 2013
Fig. 5 with image from Sun et al., 2007
Fig. 1 from Araki et al., 2001
pax3a Fig. 5 with image from Hammond et al., 2007
pax7a Fig. 5 with image from Hammond et al., 2007
sox3 Fig. 5 with image from Sun et al., 2007
sox32 Fig. 3 with image from Matsui et al., 2011
tbxta Fig. 8 with image from Warga et al., 2013
Fig. 3 with image from Matsui et al., 2011
Phenotype
Phenotype resulting from MO3-fgf8a
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO3-fgf8a Fig. 6 with image from Dworkin et al., 2012
cerebellum absent, abnormal WT + MO3-fgf8a Fig. 6 with image from Dworkin et al., 2012
cerebellum aplastic, abnormal WT + MO3-fgf8a Fig. 1 from Araki et al., 2001
forerunner cell group distributed, abnormal WT + MO3-fgf8a Fig. 3 with image from Matsui et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-fgf8a Fig. 4 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased length, abnormal WT + MO3-fgf8a Fig. 4 with image from Liu et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO3-fgf8a Fig. 1 from Araki et al., 2001
midbrain hindbrain boundary morphology, abnormal pt6Tg + MO3-fgf8a Fig. 3 with image from Molina et al., 2007
otic vesicle morphology, abnormal pt6Tg + MO3-fgf8a Fig. 3 with image from Molina et al., 2007
retina morphology, abnormal pt6Tg + MO3-fgf8a Fig. 3 with image from Molina et al., 2007
ventricular system morphology, abnormal WT + MO3-fgf8a Fig. 6 with image from Dworkin et al., 2012
Phenotype of all Fish created by or utilizing MO3-fgf8a
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal WT + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO3-fgf8a standard conditions Fig. 1 from Araki et al., 2001
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
brain apoptotic, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
cerebellum absent, abnormal WT + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
cerebellum aplastic, abnormal WT + MO3-fgf8a standard conditions Fig. 1 from Araki et al., 2001
forerunner cell group distributed, abnormal WT + MO3-fgf8a standard conditions Fig. 3 with image from Matsui et al., 2011
otic vesicle morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
retina morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
midbrain hindbrain boundary morphology, abnormal pt6Tg + MO3-fgf8a standard conditions Fig. 3 with image from Molina et al., 2007
closure of optic fissure process quality, ameliorated AB + MO1-adamts16 + MO3-fgf8a standard conditions Fig. 5 with image from Cao et al., 2018
closure of optic fissure process quality, ameliorated AB + MO2-adamts16 + MO3-fgf8a standard conditions Fig. 5 with image from Cao et al., 2018
epibranchial field pax2a expression absent, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 5 with image from Sun et al., 2007
epibranchial field sox3 expression absent, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 5 with image from Sun et al., 2007
midbrain development disrupted, abnormal WT + MO1-fgf3 + MO3-fgf8a standard conditions Fig. 9 with image from Miyake et al., 2014
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-fgf6a + MO3-fgf8a standard conditions Fig. 3 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression decreased distribution, abnormal WT + MO1-fgf6a + MO3-fgf8a standard conditions Fig. 3 with image from Osborn et al., 2020
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-fgf24 + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-fgf24 + MO3-fgf8a standard conditions Fig. 4 with image from Liu et al., 2011
brain apoptotic, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
midbrain hindbrain boundary absent, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-grhl2a + MO3-fgf8a standard conditions Fig. 6 with image from Dworkin et al., 2012
pancreas mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
liver mislocalised, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
determination of liver left/right asymmetry disrupted, abnormal WT + MO3-fgf4 + MO3-fgf8a standard conditions Fig. 2 with image from Yamauchi et al., 2009
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO3-fgf8a + MO5-fgf4 standard conditions Fig. 3 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO3-fgf8a + MO5-fgf4 standard conditions Fig. 3 with image from Osborn et al., 2020
segmental plate adaxial cell myod1 expression decreased distribution, abnormal WT + MO3-fgf8a + MO5-fgf4 chemical treatment: Cyclopamine Fig. 3 with image from Osborn et al., 2020
paraxial mesoderm myod1 expression absent, abnormal WT + MO3-fgf8a + MO5-fgf4 chemical treatment: Cyclopamine Fig. 3 with image from Osborn et al., 2020
presumptive paraxial mesoderm myod1 expression absent, abnormal WT + MO1-fgf6a + MO3-fgf8a + MO5-fgf4 standard conditions Fig. 3 with image from Osborn et al., 2020
presumptive paraxial mesoderm myf5 expression decreased distribution, abnormal WT + MO1-fgf6a + MO3-fgf8a + MO5-fgf4 standard conditions Fig. 3 with image from Osborn et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.