CRISPR

CRISPR2-pomt2

ID

ZDB-CRISPR-240208-8

Name

CRISPR2-pomt2

Previous Names

None

Target

pomt2 (1)

Sequence

5' - GCCCGTTTTTATTTTGGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3886	pomt2

Expression

Gene expression in Wild Types + CRISPR2-pomt2

No data available

Phenotype

Phenotype resulting from CRISPR2-pomt2

No data available

Phenotype of all Fish created by or utilizing CRISPR2-pomt2

Phenotype	Fish	Conditions	Figures
retinal outer nuclear layer apoptotic process increased process quality, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 4 from Liu et al., 2022
skeletal muscle cell size, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
whole organism semi-viable, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Table 1, Table 2 from Liu et al., 2022
skeletal muscle Ab1-eys labeling absent, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 1 from Liu et al., 2022
skeletal muscle ab3-lam labeling absent, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 1 from Liu et al., 2022
long double cone cell decreased amount, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 6 from Liu et al., 2022
tectal ventricle increased ratio brain, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
skeletal muscle cell nucleus mislocalised, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
retinal rod cell apoptotic process increased process quality, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 4 from Liu et al., 2022
retinal cone cell decreased amount, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 6 from Liu et al., 2022
tectal ventricle increased size, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
skeletal muscle cell dystrophic, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
retinal cone cell ab2-gnat2 labeling decreased distribution, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 6 from Liu et al., 2022
valvula cerebelli hypoplastic, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
retinal outer nuclear layer Ab1-eys labeling mislocalised, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 3 from Liu et al., 2022
retinal outer nuclear layer cell body ab3-rho labeling mislocalised, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 5 from Liu et al., 2022
retinal cone cell apoptotic process increased process quality, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 4 from Liu et al., 2022
retinal outer nuclear layer ab5-rho labeling mislocalised, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 5 from Liu et al., 2022
long double cone cell ab3-rho labeling decreased distribution, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 6 from Liu et al., 2022
head domed, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 2 from Liu et al., 2022
retinal outer nuclear layer cell body fiber ab3-rho labeling mislocalised, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 5 from Liu et al., 2022
skeletal muscle ab1-dag1 labeling absent, abnormal	pomt2^{zf3886/zf3886} (AB/TU)	standard conditions	Figure 1 from Liu et al., 2022

Citations