CRISPR

CRISPR1-gla

ID

ZDB-CRISPR-231116-2

Name

CRISPR1-gla

Previous Names

None

Target

gla (1)

Sequence

5' - GCAGAAGATCGTCGTCCCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
huh1	gla

Expression

Gene expression in Wild Types + CRISPR1-gla

No data available

Phenotype

Phenotype resulting from CRISPR1-gla

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gla

Phenotype	Fish	Conditions	Figures
kidney Ab2-ctsb labeling decreased amount, abnormal	gla^huh1/huh1	standard conditions	Figure 4 from Elsaid et al., 2022
kidney Ab1-idh3 labeling decreased amount, abnormal	gla^huh1/huh1	standard conditions	Figure 4 from Elsaid et al., 2022
renal capsular space decreased thickness, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2022
kidney alpha-galactosidase activity decreased process quality, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2022
proximal convoluted tubule mitochondrion morphology, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023
capillary loop nephron dilated, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2022
renal glomerulus gla expression absent, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2022
kidney Ab3-sod2 labeling decreased distribution, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2023
proximal convoluted tubule mitochondrion decreased circumference, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023
proximal convoluted tubule mitochondrion increased area, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023
urine protein increased amount, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 5 from Elsaid et al., 2022
podocyte podocyte foot increased width, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 5 from Elsaid et al., 2022
proximal convoluted tubule mitochondrion increased diameter, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023
kidney antioxidant decreased amount, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 3 from Elsaid et al., 2023
proximal convoluted tubule mitochondrial crista decreased area, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 3 from Elsaid et al., 2023
distal early tubule mitochondrion area density, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023
renal tubule cytoplasm gla expression absent, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2022
kidney Ab1-cd63 labeling decreased distribution, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 4 from Elsaid et al., 2023
blood plasma creatine increased amount, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 5 from Elsaid et al., 2022
distal early tubule mitochondrial crista decreased area, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 3 from Elsaid et al., 2023
proximal convoluted tubule mitochondrion increased perimeter, abnormal	gla^huh1/huh1 (AB/TU)	standard conditions	Fig. 2 from Elsaid et al., 2023

Citations