CRISPR

CRISPR3-gata5

ID
ZDB-CRISPR-210322-1
Name
CRISPR3-gata5
Previous Names
None
Target
Sequence
5' - GGGCGCGAGTGTGTGAACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hsc115 gata5
wcm10 gata5
wcm11 gata5
wcm8 gata5
wcm9 gata5
Expression
Gene expression in Wild Types + CRISPR3-gata5
No data available
Phenotype
Phenotype resulting from CRISPR3-gata5
No data available
Phenotype of all Fish created by or utilizing CRISPR3-gata5
Phenotype Fish Conditions Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal gata5wcm8/wcm8 standard conditions Fig. 3. with image from Sam et al., 2020
heart tube split bilaterally, abnormal gata5wcm8/wcm8 standard conditions Fig. 4. with image from Sam et al., 2020
heart bifurcated, abnormal gata5wcm8/wcm8 standard conditions Fig. S1 from Sam et al., 2020
pericardium edematous, abnormal gata5wcm8/wcm8 standard conditions Fig. 1. with imageFig. S1 from Sam et al., 2020
cardiac muscle cell myl7 expression decreased amount, abnormal gata5wcm8/wcm8 standard conditions Fig. 3. with imageFig. 4. with image from Sam et al., 2020
heart primordium nkx2.5 expression decreased amount, abnormal gata5wcm8/wcm8 standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell myl7 expression spatial pattern, abnormal gata5wcm8/wcm8 standard conditions Fig. 3. with image from Sam et al., 2020
whole organism dead, abnormal gata5wcm8/wcm8 standard conditions text only from Sam et al., 2020
myocardial precursor mislocalised laterally, abnormal gata5wcm8/wcm8 standard conditions Fig. 3. with imageFig. 4. with image from Sam et al., 2020
heart tube decreased thickness, abnormal gata5wcm8/+; gata4wcm6/wcm6 standard conditions Fig. 4. with image from Sam et al., 2020
cardiac muscle cell myl7 expression decreased amount, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 4. with image from Sam et al., 2020
heart tube morphology, ameliorated gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 4. with image from Sam et al., 2020
heart tube decreased length, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 5. with image from Sam et al., 2020
heart looping process quality, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 5. with image from Sam et al., 2020
heart tube linear, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 5. with image from Sam et al., 2020
embryonic heart tube elongation process quality, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 5. with image from Sam et al., 2020
heart primordium nkx2.5 expression decreased amount, abnormal gata5wcm8/wcm8; gata4wcm6/+ standard conditions Fig. 4. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/wcm8; gata4wcm6/wcm6 standard conditions Fig. 6. with image from Sam et al., 2020
cardiac muscle cell myl7 expression decreased amount, abnormal gata5wcm8/wcm8; gata4wcm6/wcm6 standard conditions Fig. 4. with image from Sam et al., 2020
heart tube morphology, ameliorated gata5wcm8/wcm8; gata4wcm6/wcm6 standard conditions Fig. 4. with image from Sam et al., 2020
heart primordium nkx2.5 expression decreased amount, abnormal gata5wcm8/wcm8; gata4wcm6/wcm6 standard conditions Fig. 4. with image from Sam et al., 2020
cardiac muscle cell myl7 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/+ standard conditions Fig. 3. with image from Sam et al., 2020
heart primordium nkx2.5 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/+ standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell myl7 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart primordium absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart primordium nkx2.5 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart tube decreased thickness, abnormal gata5wcm8/+; gata6wcm7/+; gata4wcm6/+ standard conditions Fig. 6. with image from Sam et al., 2020
heart tube straight, abnormal gata5wcm8/+; gata6wcm7/+; gata4wcm6/+ standard conditions Fig. 6. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/+; gata6wcm7/wcm7; gata4wcm6/wcm6 standard conditions Fig. 6. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/wcm8; gata6wcm7/+; gata4wcm6/wcm6 standard conditions Fig. 6. with image from Sam et al., 2020
Citations