CRISPR

CRISPR2-stat3

ID

ZDB-CRISPR-181119-43

Name

CRISPR2-stat3

Previous Names

Z001460 (1)

Target

stat3 (2)

Sequence

5' - GGTGCTGCTTGATGCGCCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

CRISPRz:Z001460 (1)

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mdu35	stat3
zf3708	stat3

Expression

Gene expression in Wild Types + CRISPR2-stat3

No data available

Phenotype

Phenotype resulting from CRISPR2-stat3

No data available

Phenotype of all Fish created by or utilizing CRISPR2-stat3

Phenotype	Fish	Conditions	Figures
osteoblast col10a1a expression decreased amount, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
opercle bone development decreased occurrence, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
osteoblast spp1 expression decreased amount, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
osteoprogenitor cell runx2b expression decreased amount, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
cleithrum bone development decreased occurrence, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
whole organism viability, abnormal	stat3^mdu35/mdu35	amputation: caudal fin	Figure 6 from Sobah et al., 2023
whole organism decreased size, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 1 from Sobah et al., 2023
caudal fin fin regeneration disrupted, abnormal	stat3^mdu35/mdu35	amputation: caudal fin	Figure 6 from Sobah et al., 2023
whole organism viability, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 2 from Sobah et al., 2023
vertebral column curved, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 2 , Figure 3 from Sobah et al., 2023
ceratobranchial bone bone development decreased occurrence, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
mandibular arch skeleton morphology, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 2 from Sobah et al., 2023
ceratohyal bone bone development decreased occurrence, abnormal	stat3^mdu35/mdu35	standard conditions	Figure 4 from Sobah et al., 2023
innate immune response decreased magnitude, abnormal	stat3^mdu35/mdu35; gl22Tg	standard conditions	Figure 7 from Sobah et al., 2023
caudal fin macrophage decreased amount, abnormal	stat3^mdu35/mdu35; gl22Tg	standard conditions	Figure 7 from Sobah et al., 2023
innate immune response decreased magnitude, abnormal	stat3^mdu35/mdu35; i114Tg	standard conditions	Figure 7 from Sobah et al., 2023
caudal fin neutrophil decreased amount, abnormal	stat3^mdu35/mdu35; i114Tg	standard conditions	Figure 7 from Sobah et al., 2023

Citations