CRISPR

CRISPR1-slc39a14

ID

ZDB-CRISPR-160727-1

Name

CRISPR1-slc39a14

Previous Names

None

Target

slc39a14 (1)

Sequence

5' - GGCCTTCGGGTTTGACCCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
u801	slc39a14

Expression

Gene expression in Wild Types + CRISPR1-slc39a14

No data available

Phenotype

Phenotype resulting from CRISPR1-slc39a14

No data available

Phenotype of all Fish created by or utilizing CRISPR1-slc39a14

Phenotype	Fish	Conditions	Figures
whole organism soul5 expression increased amount, abnormal	slc39a14^u801/u801	standard conditions	Fig. 1 from Tuschl et al., 2022
whole organism cdh24b expression amount, ameliorated	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 1 from Tuschl et al., 2022
optic tectum fosab expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
optic tectum fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
whole organism pcdh7b expression amount, ameliorated	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 7 from Tuschl et al., 2022
central zone of the optic tectum fosab expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
whole organism manganese atom increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 5 from Tuschl et al., 2022
locomotion occurrence, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 5 from Tuschl et al., 2022
whole organism bdnf expression decreased amount, abnormal	slc39a14^u801/u801	standard conditions	Fig. 2 from Tuschl et al., 2022
preoptic area fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
caudal hypothalamic zone fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
whole organism magnesium atom decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 5 from Tuschl et al., 2022
whole organism bdnf expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 2 from Tuschl et al., 2022
whole organism pde6c expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 3 from Tuschl et al., 2022
whole organism opn1mw2 expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 1 from Tuschl et al., 2022
torus semicircularis fosab expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
whole organism calcium atom decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 5 from Tuschl et al., 2022
pretectum fosab expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
melanocyte dispersed, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 6 from Tuschl et al., 2022
whole organism add2 expression decreased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 7 from Tuschl et al., 2022
olfactory bulb fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
whole organism hspa5 expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 3 from Tuschl et al., 2022
whole organism soul5 expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 1 from Tuschl et al., 2022
ventral telencephalon fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
dorsal telencephalon fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
postoptic commissure fosab expression increased amount, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 4 from Tuschl et al., 2022
optomotor response decreased linear velocity, abnormal	slc39a14^u801/u801	chemical treatment by environment: manganese(II) chloride	Fig. 6 from Tuschl et al., 2022
whole organism slc39a14 expression decreased amount, abnormal	slc39a14^u801/u801 (AB)	standard conditions	Fig. 5 from Tuschl et al., 2016
whole organism intracellular manganese ion homeostasis process quality, ameliorated	slc39a14^u801/u801 (AB)	chemical treatment by injection: EDTA monocalcium diisodium salt, chemical treatment by environment: manganese(II) chloride	Fig. 7 from Tuschl et al., 2016
whole organism intracellular manganese ion homeostasis decreased process quality, abnormal	slc39a14^u801/u801 (AB)	standard conditions	Fig. 6 from Tuschl et al., 2016
whole organism intracellular manganese ion homeostasis decreased process quality, abnormal	slc39a14^u801/u801 (AB)	chemical treatment by environment: manganese(II) chloride	Fig. 7 from Tuschl et al., 2016
intracellular manganese ion homeostasis decreased process quality, abnormal	slc39a14^u801/u801 (AB)	chemical treatment by environment: manganese(II) chloride	Fig. 6 from Tuschl et al., 2016
brain intracellular manganese ion homeostasis decreased process quality, abnormal	slc39a14^u801/u801 (AB)	standard conditions	Fig. 7 from Tuschl et al., 2016
locomotion involved in locomotory behavior decreased occurrence, abnormal	slc39a14^u801/u801 (AB)	chemical treatment by environment: manganese(II) chloride	Fig. 6 from Tuschl et al., 2016

Citations