a Scheme of the 3C rationale. A Cre effector construct controls the expression of a floxed Stop cassette upstream of the sequence encoding a fusion protein of Cas9 and GFP. In addition, a U6a promoter drives the constitutive expression of a gRNA targeting a gene of interest (GOI). Following exogenous or transgenic Cre supply, site-specific recombination results in the expression of Cas9-GFP. Combined with the gRNA a functional CRISPR complex is formed and mutates the target site within the gene of interest. b Scheme of the 3C gene inactivation construct targeting tyrosinase (tyr). The temperature-inducible hsp70l promotor drives expression of a floxed DsRed cassette. c Identification of transgenic animals expressing DsRed at 50 hpf after a heat treatment at 24 hpf. Example shown is a representative of a total of >100 heat-treated clutches from four independent 3C tyr transgenic insertions. Scale bar: 1000 µm.

a Timeline. Cre mRNA injections at the 1-cell stage elicit ubiquitous recombination (blue box). At 12 hpf, a heat treatment triggers transient Cas9-GFP expression causing the subsequent permanent mutagenesis of the tyr target site (green box). Analysis of GFP expression and pigmentation was conducted at 22 and 50 hpf, respectively. b Expression of GFP is detected in a ubiquitous fashion at 22 hpf. In comparison to controls (ctrl), GFP-positive embryos (GFP+) display a significant loss of black pigment along the body (c) and in the developing eye (d). Examples shown are representatives across five experiments showing the same result. A total of >150 GFP-positive individuals and their respective non-GFP-positive siblings were analyzed. Scale bars: 150 µm in b and d; 500 µm in c. e Graph showing quantification of RPE pigmentation determined using the mean of the histogram from images of control embryos expressing no fluorescent protein (Non-FP), DsRed-positive (DsRed+), and GFP-positive (GFP+) siblings as well as tyrosinase mutants (tyr^−/−) at 50 hpf. n (Non-FP, DsRed+, tyr^−/−) = 12; n (GFP+) = 18. Data were analyzed using one-way ANOVA, followed by Tukey’s post hoc test. Values are presented as mean ± SEM; ****p ≤ 0.0001, ns (non-significant) >0.9999.

a Scheme of the tyr locus at chromosome 15. Exon sequences with translated and untranslated regions are represented in dark and light gray, respectively. Position of the CRISPR/Cas9 target in the first exon is indicated with an orange box. Forward and reverse primers used for amplification of the target site (for and rev) are shown as half arrows. Scale bar: 200 base pairs (bp). Next generation sequencing of FAC-sorted cells from pooled embryos (see Supplementary Fig. 1a) revealed a single-nucleotide polymorphism at the first position of the protospacer adjacent motif (PAM) indicated with a dark gray box downstream to the target site (gRNA) indicated by a light gray box. b, c Distribution of identified alleles around the cleavage site for the guide GGACTGGAGGACTTCTGGGG in control (ctrl) and GFP-positive cells (GFP+). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site. Sequencing of controls (b) shows presence of the parental strands with a frequency of 48.26 and 38.46% which drops to 7.15 and 0.48% in GFP-positive cells (c). c′ Further sequence analysis of GFP-positive cells shows that 76.5 and 23.5% of the introduced indels represent frameshift and in-frame mutations, respectively.

a Timeline. Cre activity in sox10:Cre-positive animals at 10 hpf elicits recombination (blue box) in developing neural crest cells. At 16 hpf, a heat treatment triggers expression of Cas9-GFP and the subsequent permanent mutagenesis of the tyr target site (green box). Analysis of GFP expression and pigmentation was conducted at 22 and 50 hpf, respectively. b Expression of GFP is detected in neural crest cells at 22 hpf. c, d In comparison to controls (ctrl), GFP-positive embryos (GFP+) display a loss of pigmentation in the anterior head region. Examples shown are representatives across eight experiments showing the same result. A total of >160 GFP-positive individuals and their respective non-GFP-positive siblings were analyzed. Scale bars: 150 µm in b and d; 500 µm in c.

a Timeline. Application of 4-Hydroxytamoxifen (4OHT) induces Cre activity in otx2b:CreER^T2-positive animals at 6 hpf eliciting recombination (blue box) in cells of the developing anterior neural plate. At 12 hpf, a heat treatment triggers expression of Cas9-GFP and the subsequent mutagenesis of the tyr target site (green box). Analysis of GFP expression and pigmentation was conducted at 22 and 50 hpf, respectively. b Expression of GFP is detected in cells of the developing fore-, midbrain and eyes at 22 hpf. c, d In comparison to controls (ctrl), GFP-positive embryos (GFP+) display no pigmentation loss in cells along the body, but significant pigmentation defects in the developing eyes. Examples shown are representatives across ten experiments showing the same result. A total of >200 GFP-positive individuals and their respective non-GFP-positive siblings were analyzed. Scale bars: 150 µm in b and d; 500 µm in c. e Graph showing quantification of RPE pigmentation determined using the mean of the histogram from images of control embryos expressing no fluorescent protein (Non-FP), DsRed-positive (DsRed+), and GFP-positive (GFP+) siblings as well as tyrosinase mutants (tyr^−/−) at 50 hpf. n (Non-FP, DsRed+, tyr^−/−) = 12; n (GFP+) = 18. Data were analyzed using one-way ANOVA, followed by Tukey’s post hoc test. Values are presented as mean ± SEM; ****p ≤ 0.0001, ns (non-significant) = >0.9999.

a Timeline. Cre mRNA injections into progeny of 3C tyr animals at the 1-cell stage elicit ubiquitous recombination (blue box). A subset of injected embryos was heat treated at 12 or 60 hpf to trigger Cas9-GFP expression and mutagenesis of the tyr target site (green box). In addition, Cre mRNA injected animals were collected at 120 hpf without a prior heat treatment. Single embryo genotyping was applied to all specimen and ten embryos of each time point (heat: none; heat: 12 hpf; heat 60 hpf) were combined and analyzed using next generation sequencing (NGS). In addition, siblings of all three time points were raised to adulthood (6 months postfertilization (mpf)). b Animals subjected to Cre mRNA injection but no heat treatment show neither a pigmentation phenotype at embryonic or adult stages nor any signs of mutagenesis. c A strong pigmentation phenotype is observed at embryonic (50 hpf) and adult stages (6 mpf) in animals heat treated at 12 hpf. (Note almost complete absence of pigmentation in the RPE at 6 mpf making the eye appear red.) NGS confirms high-level indel production. d Pigmentation defects are observed at adult but not at embryonic stages in animals heat treated at 60 hpf. Sequencing corroborates mutagenesis of the tyr target site. Larval examples shown are representatives across three experiments showing the same result. Adult examples shown are representative of >15 individual fish examined. e The recombined 3C tyr allele is transmitted in the germline of F0 animals subjected to Cre mRNA injection only. Heat treatment in the F1 generation results in GFP expression and pigmentation defects after activation at 12 hpf. Examples shown are representatives across ten experiments showing the same result. A total of >300 GFP-positive individuals and their respective non-GFP-positive siblings were analyzed. Scale bars: 500 µm for 50 hpf and 2 mm for 6 mpf in b–d; 150 µm in e, except for lower row with 500 µm.