TALEN

TALEN1-dyrk1aa

ID
ZDB-TALEN-180322-1
Name
TALEN1-dyrk1aa
Previous Names
None
Target
Target Sequence 1
5' - TGGGTCGCCATCAAGATCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - TGAGCCTGATTCAGGAAGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
krb1 dyrk1aa
Expression
Gene expression in Wild Types + TALEN1-dyrk1aa
No data available
Phenotype
Phenotype resulting from TALEN1-dyrk1aa
No data available
Phenotype of all Fish created by or utilizing TALEN1-dyrk1aa
Phenotype Fish Conditions Figures
central artery structure, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 4. with image from Cho et al., 2019
whole organism pcdh1g30 expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
whole organism ldlrb expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
whole organism myl4 expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
whole organism f7i expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
male organism biological process involved in interspecies interaction between organisms disrupted, exacerbated dyrk1aakrb1/krb1 standard conditions text only from Aslanzadeh et al., 2019
male organism swimming increased duration, abnormal dyrk1aakrb1/krb1 standard conditions text only from Aslanzadeh et al., 2019
brain hemorrhagic, abnormal dyrk1aakrb1/krb1 heat shock Fig. 1. with image from Cho et al., 2019
social behavior process quality, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 4 with image,  Fig. 6 with image,  Fig. 7 with image from Kim et al., 2017
midbrain hemorrhagic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image from Cho et al., 2019
brain morphology, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image,  Fig. 6. with image from Cho et al., 2019
forebrain hemorrhagic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image from Cho et al., 2019
hindbrain vasculature kdrl expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S1 with image from Cho et al., 2019
retina hemorrhagic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image from Cho et al., 2019
locomotory exploration behavior process quality, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 3 with image from Kim et al., 2017
whole organism pcdh1g1 expression increased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
telencephalon decreased size, abnormal dyrk1aakrb1/krb1 standard conditions Fig. s2 with image from Kim et al., 2017
whole organism pcdh2ab10 expression increased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
central artery morphology, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 4. with image from Cho et al., 2019
whole organism pcdh1g18 expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
whole organism pcdh1gc6 expression increased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
tectal ventricle increased size, abnormal dyrk1aakrb1/krb1 standard conditions Fig. s2 with image from Kim et al., 2017
brain hemorrhagic, ameliorated dyrk1aakrb1/krb1 chemical treatment by environment: tacrolimus (anhydrous) Fig. 8. with image from Cho et al., 2019
brain hemorrhagic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image,  Fig. 3. with image,  Fig. 6. with image,  Fig. 8. with image from Cho et al., 2019
brain hemorrhagic, ameliorated dyrk1aakrb1/krb1 chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 6. with image from Cho et al., 2019
brain apoptotic process increased process quality, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 2 with image from Kim et al., 2017
hindbrain vasculature dll4 expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S1 with image from Cho et al., 2019
brain morphology, abnormal dyrk1aakrb1/krb1 heat shock Fig. 1. with image from Cho et al., 2019
whole organism capn8 expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
preoptic area crhb expression decreased amount, abnormal dyrk1aakrb1/krb1 stress, undercrowding Fig. 5 with image from Kim et al., 2017
corpus cerebelli decreased size, abnormal dyrk1aakrb1/krb1 standard conditions Fig. s2 with image from Kim et al., 2017
whole organism capn2l expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
whole organism anxa1d expression increased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. S6 from Cho et al., 2019
optic tectum decreased size, abnormal dyrk1aakrb1/krb1 standard conditions Fig. s2 with image from Kim et al., 2017
brain decreased size, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 2 with image,  Fig. s2 with image from Kim et al., 2017
diffuse nucleus inferior lobe fosab expression increased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 5 with image from Kim et al., 2017
male organism social behavior occurrence, exacerbated dyrk1aakrb1/krb1 standard conditions text only from Aslanzadeh et al., 2019
brain apoptotic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 2 with image from Kim et al., 2017
ventral hypothalamic zone fosab expression decreased amount, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 5 with image from Kim et al., 2017
hindbrain hemorrhagic, abnormal dyrk1aakrb1/krb1 standard conditions Fig. 1. with image from Cho et al., 2019
male organism social behavior occurrence, abnormal dyrk1aakrb1/+ standard conditions text only from Aslanzadeh et al., 2019
male organism swimming increased duration, abnormal dyrk1aakrb1/+ standard conditions text only from Aslanzadeh et al., 2019
male organism biological process involved in interspecies interaction between organisms disrupted, abnormal dyrk1aakrb1/+ standard conditions text only from Aslanzadeh et al., 2019
endothelial cell pcdh1g1 expression increased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
central artery amount, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: tacrolimus (anhydrous) Fig. 8. with image from Cho et al., 2019
endothelial cell capn2l expression decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
endothelial cell pcdh1g18 expression decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
endothelial cell capn8 expression decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
central artery decreased branchiness, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. 1. with image,  Fig. 3. with image,  Fig. 6. with image,  Fig. 8. with image from Cho et al., 2019
central artery length, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 6. with image from Cho et al., 2019
endothelial cell pcdh1gc6 expression increased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
central artery branchiness, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 6. with image from Cho et al., 2019
central artery length, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: tacrolimus (anhydrous) Fig. 8. with image from Cho et al., 2019
endothelial cell pcdh1g30 expression decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
central artery decreased length, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. 1. with image,  Fig. 3. with image,  Fig. 6. with image,  Fig. 8. with image from Cho et al., 2019
central artery morphology, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. 1. with image,  Fig. 3. with image,  Fig. 6. with image from Cho et al., 2019
central artery structure, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. 1. with image,  Fig. 3. with image from Cho et al., 2019
central artery branchiness, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: tacrolimus (anhydrous) Fig. 8. with image from Cho et al., 2019
central artery decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. 8. with image from Cho et al., 2019
endothelial cell myl4 expression decreased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
endothelial cell pcdh2ab10 expression increased amount, abnormal dyrk1aakrb1/krb1; la116Tg standard conditions Fig. S6 from Cho et al., 2019
central artery morphology, ameliorated dyrk1aakrb1/krb1; la116Tg chemical treatment by environment: ethylene glycol bis(2-aminoethyl)tetraacetic acid Fig. 6. with image from Cho et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.