TALEN

TALEN1-nr5a2

ID
ZDB-TALEN-161128-1
Name
TALEN1-nr5a2
Previous Names
None
Target
Target Sequence 1
5' - CCTACGACGAAGACTTGGAT - 3'
Target Sequence 2
5' - ATCCGGACACCTTGTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
oz3 nr5a2
Expression
Gene expression in Wild Types + TALEN1-nr5a2
No data available
Phenotype
Phenotype resulting from TALEN1-nr5a2
No data available
Phenotype of all Fish created by or utilizing TALEN1-nr5a2
Phenotype Fish Conditions Figures
acinar cell prss1 expression absent, abnormal nr5a2oz3/oz3 standard conditions Fig. S1 with image from Nissim et al., 2016
digestive tract morphogenesis decreased process quality, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver prox1a expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud foxa3 expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
pancreas development decreased process quality, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
exocrine pancreas decreased size, abnormal nr5a2oz3/oz3 standard conditions Fig. 2 with image from Nissim et al., 2016
exocrine pancreas prss1 expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 2 with image from Nissim et al., 2016
pancreatic bud hhex expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud prox1a expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver hhex expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver foxa3 expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud decreased size, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver fabp10a expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 2 with image from Nissim et al., 2016
liver development decreased process quality, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver hnf4a expression decreased distribution, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver decreased size, abnormal nr5a2oz3/oz3 standard conditions Fig. 2 with imageFig. 4 with image from Nissim et al., 2016
exocrine pancreas cpa5 expression absent, abnormal nr5a2oz3/oz3 standard conditions Fig. S1 with image from Nissim et al., 2016
pancreas morphogenesis process quality, abnormal nr5a2oz3/oz3 standard conditions Fig. 4 with image from Nissim et al., 2016
liver prox1a expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud foxa3 expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
digestive tract morphogenesis decreased process quality, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
pancreas development decreased process quality, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
exocrine pancreas decreased size, abnormal nr5a2oz3/+ standard conditions Fig. 2 with image from Nissim et al., 2016
pancreatic bud hhex expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
exocrine pancreas prss1 expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 2 with image from Nissim et al., 2016
exocrine pancreas prss1 expression decreased distribution, abnormal nr5a2oz3/+ chemical treatment: 1-(3'-{1-[2-(morpholin-4-yl)ethyl]pyrazol-3-yl}[1,1'-biphenyl]-3-yl)ethan-1-one Fig. 5 with image from Nissim et al., 2016
liver hhex expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud prox1a expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
liver foxa3 expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
pancreatic bud decreased size, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
liver fabp10a expression decreased distribution, abnormal nr5a2oz3/+ standard conditions Fig. 2 with image from Nissim et al., 2016
liver development decreased process quality, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
exocrine pancreas decreased size, abnormal nr5a2oz3/+ chemical treatment: 1-(3'-{1-[2-(morpholin-4-yl)ethyl]pyrazol-3-yl}[1,1'-biphenyl]-3-yl)ethan-1-one Fig. 5 with image from Nissim et al., 2016
liver decreased size, abnormal nr5a2oz3/+ standard conditions Fig. 2 with imageFig. 4 with image from Nissim et al., 2016
pancreas morphogenesis process quality, abnormal nr5a2oz3/+ standard conditions Fig. 4 with image from Nissim et al., 2016
Citations