TALEN

TALEN1-cftr

ID
ZDB-TALEN-131024-1
Name
TALEN1-cftr
Previous Names
None
Target
Target Sequence 1
5' - GGGTATGGCCCATTTTATAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - GTACACAGGATGCATT - 3'
ZFIN BLAST NCBI BLAST Ensembl
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The TALEN used to generate the cftr mutant alleles reported here was composed of the following TAL effector domains: NN NN NN NG NI NG NN NN HD HD HD NI NG NG NG NG NI NG NI NG and NN NG NI HD NI HD NI NN NN NI NG NN HD NI NG NG.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
pd1048 cftr
pd1049 cftr
pd1050 cftr
scu102 cftr
Expression
Gene expression in Wild Types + TALEN1-cftr
No data available
Phenotype
Phenotype resulting from TALEN1-cftr
No data available
Phenotype of all Fish created by or utilizing TALEN1-cftr
Phenotype Fish Conditions Figures
Kupffer's vesicle decreased volume, abnormal cftrpd1048/pd1048 standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle development decreased process quality, abnormal cftrpd1048/pd1048 standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle unlumenized, abnormal cftrpd1048/pd1048 standard conditions Fig. 3 with image from Navis et al., 2013
brain elovl6 expression spatial pattern, abnormal cftrpd1048/pd1048 (AB/TU) standard conditions Fig. 7 with image from Ji et al., 2016
left/right pattern formation disrupted, abnormal cftrpd1048/pd1048 (AB/TU) standard conditions Fig. 7 with image from Ji et al., 2016
brain right side elovl6 expression mislocalised, abnormal cftrpd1048/pd1048 (AB/TU) standard conditions Fig. 7 with image from Ji et al., 2016
protein kinase A signaling increased occurrence, abnormal cftrpd1049/pd1049 chemical treatment: 3-isobutyl-1-methylxanthine, chemical treatment: forskolin Fig. 8 with image from Navis et al., 2013
Kupffer's vesicle development decreased process quality, abnormal cftrpd1049/pd1049 standard conditions Fig. 3 with image,  Fig. 8 with image from Navis et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal cftrpd1049/pd1049 standard conditions Fig. 2 with image from Navis et al., 2013
Kupffer's vesicle unlumenized, abnormal cftrpd1049/pd1049 chemical treatment: 3-isobutyl-1-methylxanthine, chemical treatment: forskolin Fig. 8 with image from Navis et al., 2013
Kupffer's vesicle unlumenized, abnormal cftrpd1049/pd1049 standard conditions Fig. 3 with image,  Fig. 8 with image from Navis et al., 2013
determination of left/right symmetry decreased process quality, abnormal cftrpd1049/pd1049 standard conditions Fig. 2 with image from Navis et al., 2013
heart looping decreased process quality, abnormal cftrpd1049/pd1049 standard conditions Fig. 2 with image from Navis et al., 2013
pancreas decreased size, abnormal cftrpd1049/pd1049 standard conditions Fig. 7 from Delaspre et al., 2015
defense response to bacterium decreased efficacy, abnormal cftrpd1049/pd1049 bacterial treatment by injection: Mycobacteroides abscessus Fig. 1 with image from Bernut et al., 2019
Kupffer's vesicle development decreased process quality, abnormal cftrpd1049/pd1049 chemical treatment: 3-isobutyl-1-methylxanthine, chemical treatment: forskolin Fig. 8 with image from Navis et al., 2013
pancreatic centroacinar cell decreased amount, abnormal cftrpd1049/pd1049 standard conditions Fig. 7 from Delaspre et al., 2015
Kupffer's vesicle absent, abnormal cftrpd1049/pd1049 standard conditions Fig. S5 from Delaspre et al., 2015
whole organism decreased life span, abnormal cftrpd1049/pd1049 bacterial treatment by injection: Mycobacteroides abscessus Fig. 1 with image from Bernut et al., 2019
Kupffer's vesicle decreased volume, abnormal cftrpd1049/pd1049 standard conditions Fig. 3 with image,  Fig. 8 with image from Navis et al., 2013
Kupffer's vesicle decreased volume, abnormal cftrpd1049/pd1049 chemical treatment: 3-isobutyl-1-methylxanthine, chemical treatment: forskolin Fig. 8 with image from Navis et al., 2013
secondary islet cell decreased amount, abnormal cftrpd1049/pd1049 standard conditions Fig. 7 from Delaspre et al., 2015
heart mislocalised, abnormal cftrpd1049/pd1049 standard conditions Fig. 2 with image from Navis et al., 2013
pancreas degenerate, abnormal cftrpd1049/pd1049 (AB) standard conditions Fig. 5 with image from Navis et al., 2015
exocrine pancreas central region lacks all parts of type pancreatic acinar cell, abnormal cftrpd1049/pd1049 (AB) standard conditions Fig. 5 with image from Navis et al., 2015
pancreatic duct obstructed, abnormal cftrpd1049/pd1049 (AB) standard conditions Fig. 5 with image from Navis et al., 2015
pancreatic duct dilated, abnormal cftrpd1049/pd1049 (AB) standard conditions Fig. 5 with image from Navis et al., 2015
exocrine pancreas fibrillary, abnormal cftrpd1049/pd1049 (AB) standard conditions Fig. 5 with image from Navis et al., 2015
Kupffer's vesicle decreased volume, abnormal cftrpd1050/pd1050 standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle development decreased process quality, abnormal cftrpd1050/pd1050 standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle unlumenized, abnormal cftrpd1050/pd1050 standard conditions Fig. 3 with image from Navis et al., 2013
thymic epithelium ccl25a expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. 1 from Lin et al., 2021
thymus rag2 expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. 1 from Lin et al., 2021
thymus ccr9a expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. 1 from Lin et al., 2021
neutrophil mpx expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. S2 from Lin et al., 2021
thymic epithelium foxn1 expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. 1 from Lin et al., 2021
thymus rag1 expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. 1,  Fig. S1 from Lin et al., 2021
macrophage csf1ra expression decreased amount, abnormal cftrscu102/scu102 standard conditions Fig. S2 from Lin et al., 2021
shield chrd expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1,  Fig. 3 from Liu et al., 2020
endoderm sox17 expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
forerunner cell group sox17 expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
mesoderm tbxta expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
gastrula cell gata2a expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
somite myod1 expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 2 from Liu et al., 2020
shield gsc expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1,  Fig. 3 from Liu et al., 2020
neuroectoderm anterior region otx2b expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
gastrula cell ventral region eve1 expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
gastrula cell ventral region bmp4 expression decreased distribution, abnormal cftrscu102/scu102 (AB) standard conditions Fig. 1 from Liu et al., 2020
whole organism dvl3a expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
mesoderm cdx4 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
whole organism dvl2 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
myeloid lineage restricted progenitor cell spi1b expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image from Sun et al., 2018
intermediate cell mass of mesoderm hbbe3 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image from Sun et al., 2018
intermediate cell mass of mesoderm myb expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image,  Fig. S16 with image,  Fig. S18 with image from Sun et al., 2018
erythroid lineage cell gata1a expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. S6 with image from Sun et al., 2018
whole organism lef1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
common myeloid progenitor myb expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image,  Fig. S16 with image,  Fig. S18 with image from Sun et al., 2018
lateral plate mesoderm lmo2 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image from Sun et al., 2018
common myeloid progenitor runx1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image,  Fig. S16 with image,  Fig. S18 with image from Sun et al., 2018
lateral plate mesoderm gata2a expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image from Sun et al., 2018
mesoderm hoxa9a expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
lateral plate mesoderm tal1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Sun et al., 2018
common myeloid progenitor tal1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. S6 with image from Sun et al., 2018
intermediate cell mass of mesoderm runx1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image,  Fig. S16 with image,  Fig. S18 with image from Sun et al., 2018
erythroid lineage cell hbbe3 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image from Sun et al., 2018
lateral plate mesoderm gata1a expression decreased distribution, abnormal cftrscu102/+ standard conditions Fig. 1 with image from Sun et al., 2018
whole organism myca expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 3 with image from Sun et al., 2018
myeloid cell lcp1 expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. S6 with image from Sun et al., 2018
lateral plate mesoderm gata1a expression decreased amount, abnormal cftrscu102/+ standard conditions Fig. 2 with image,  Fig. 3 with image from Sun et al., 2018
Kupffer's vesicle development decreased process quality, abnormal cftrpd1048/pd1048; s870Tg standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle unlumenized, abnormal cftrpd1048/pd1048; s870Tg standard conditions Fig. 3 with image from Navis et al., 2013
determination of liver left/right asymmetry decreased process quality, abnormal cftrpd1049/pd1049; gz15Tg standard conditions Fig. 2 with image from Navis et al., 2013
pancreas degenerate, abnormal cftrpd1049/pd1049; gz15Tg standard conditions Fig. 4 with image,  Fig. 6 with image from Navis et al., 2015
liver mislocalised, abnormal cftrpd1049/pd1049; gz15Tg standard conditions Fig. 2 with image from Navis et al., 2013
pancreatic acinar cell decreased amount, abnormal cftrpd1049/pd1049; gz15Tg standard conditions Fig. 4 with image,  Fig. 6 with image from Navis et al., 2015
pancreatic acinar cell decreased amount, abnormal cftrpd1049/pd1049; gz15Tg chemical treatment: pharmaceutical Fig. 6 with image from Navis et al., 2015
pancreas degenerate, abnormal cftrpd1049/pd1049; gz15Tg chemical treatment: pharmaceutical Fig. 6 with image from Navis et al., 2015
pancreas lacks parts or has fewer parts of type pancreatic acinar cell, abnormal cftrpd1049/pd1049; gz15Tg standard conditions Fig. 4 with image from Navis et al., 2015
pancreatic acinar cell decreased amount, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
pancreas morphology, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
islet decreased size, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
exocrine pancreas degenerate, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
islet disorganized, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
islet increased amount, abnormal cftrpd1049/pd1049; gz15Tg; m1018Tg standard conditions Fig. 5 with image from Navis et al., 2015
pancreas neutrophil mislocalised, abnormal cftrpd1049/pd1049; nz50Tg standard conditions Fig. 6 with image from Navis et al., 2015
neutrophil migration increased occurrence, abnormal cftrpd1049/pd1049; nz50Tg standard conditions Fig. 6 with image from Navis et al., 2015
Kupffer's vesicle unlumenized, abnormal cftrpd1049/pd1049; s870Tg standard conditions Fig. 3 with image from Navis et al., 2013
Kupffer's vesicle development decreased process quality, abnormal cftrpd1049/pd1049; s870Tg standard conditions Fig. 3 with image from Navis et al., 2013
hematopoietic stem cell decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 2 from Lin et al., 2021
hematopoietic stem cell tlx1 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell tec expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell nrg1 expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt1 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt6b expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell foxc1a expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
lymphoid lineage cell migration into thymus disrupted, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 2 from Lin et al., 2021
hematopoietic stem cell lef1 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
lymphoid progenitor cell decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 2 from Lin et al., 2021
hematopoietic stem cell cacna1fb expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell cd83 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell mmp17b expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt10b expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt4 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell cdh15 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt2bb expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell socs1a expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt8a expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell cdh17 expression increased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell ikzf1 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell wnt8b expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell themis expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
hematopoietic stem cell meis3 expression decreased amount, abnormal cftrscu102/scu102; zf169Tg standard conditions Fig. 3 from Lin et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.