Morpholino

MO3-dhps

ID

ZDB-MRPHLNO-250306-2

Name

MO3-dhps

Previous Names

None

Target

dhps (1)

Sequence

5' - CACGATCAGTCTGTCACTCACCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-dhps

No data available

Phenotype

Phenotype resulting from MO3-dhps

Phenotype	Fish	Figures
head decreased size, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
integument increased pigmentation, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
optic tectum action potential initiation increased process quality, abnormal	AB + MO3-dhps	Fig. 4 from Shojaeinia et al., 2024
peptidyl-lysine modification to peptidyl-hypusine decreased process quality, abnormal	AB + MO3-dhps	Fig. 1 from Shojaeinia et al., 2024
pericardium edematous, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
post-vent region curved, abnormal	AB + MO3-dhps	Fig. 2 , Fig. 3 from Shojaeinia et al., 2024
swim bladder uninflated, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
trunk decreased length, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
whole organism Ab2-eif5a labeling decreased amount, abnormal	AB + MO3-dhps	Fig. 1 from Shojaeinia et al., 2024
whole organism Ab1-eif5a labeling decreased amount, abnormal	AB + MO3-dhps	Fig. 1 from Shojaeinia et al., 2024
whole organism Ab1-dhps labeling decreased amount, abnormal	AB + MO3-dhps	Fig. 1 from Shojaeinia et al., 2024
whole organism viability, abnormal	AB + MO3-dhps	Fig. 2 from Shojaeinia et al., 2024
whole organism cell death increased process quality, abnormal	AB + MO3-dhps	Fig. 3 from Shojaeinia et al., 2024
whole organism embryo development delayed, abnormal	AB + MO3-dhps	Fig. 2 , Fig. 3 from Shojaeinia et al., 2024

Phenotype of all Fish created by or utilizing MO3-dhps

Phenotype	Fish	Conditions	Figures
integument increased pigmentation, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
whole organism viability, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
pericardium edematous, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
swim bladder uninflated, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
whole organism cell death increased process quality, abnormal	AB + MO3-dhps	control	Fig. 3 from Shojaeinia et al., 2024
whole organism Ab2-eif5a labeling decreased amount, abnormal	AB + MO3-dhps	control	Fig. 1 from Shojaeinia et al., 2024
whole organism embryo development delayed, abnormal	AB + MO3-dhps	control	Fig. 2 , Fig. 3 from Shojaeinia et al., 2024
head decreased size, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
whole organism Ab1-eif5a labeling decreased amount, abnormal	AB + MO3-dhps	control	Fig. 1 from Shojaeinia et al., 2024
peptidyl-lysine modification to peptidyl-hypusine decreased process quality, abnormal	AB + MO3-dhps	control	Fig. 1 from Shojaeinia et al., 2024
post-vent region curved, abnormal	AB + MO3-dhps	control	Fig. 2 , Fig. 3 from Shojaeinia et al., 2024
trunk decreased length, abnormal	AB + MO3-dhps	control	Fig. 2 from Shojaeinia et al., 2024
optic tectum action potential initiation increased process quality, abnormal	AB + MO3-dhps	control	Fig. 4 from Shojaeinia et al., 2024
whole organism Ab1-dhps labeling decreased amount, abnormal	AB + MO3-dhps	control	Fig. 1 from Shojaeinia et al., 2024

Citations