Morpholino

MO1-tuba8l2

ID
ZDB-MRPHLNO-241106-2
Name
MO1-tuba8l2
Previous Names
None
Target
Sequence
5' - TTGGAGTTGGATTTGTTTTTTGCCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tuba8l2
No data available
Phenotype
Phenotype resulting from MO1-tuba8l2
Phenotype Fish Figures
motor neuron axon decreased length, abnormal AB + MO1-tuba8l2 FIGURE 2 with image,  FIGURE 4 with image from Van Schoor et al., 2024
whole organism Ab1-tuba4a labeling decreased amount, abnormal AB + MO1-tuba8l2 FIGURE 2 with image from Van Schoor et al., 2024
whole organism ab1-tuba labeling decreased amount, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
whole organism Ab16-tuba labeling decreased amount, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
whole organism Ab1-polyglutamate labeling decreased amount, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
whole organism alpha-tubulin acetylation decreased process quality, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
whole organism thigmotaxis decreased process quality, abnormal AB + MO1-tuba8l2 FIGURE 3 with image,  FIGURE 5 with image from Van Schoor et al., 2024
whole organism tubulin-glutamic acid ligase activity decreased process quality, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
whole organism tubulin-tyrosine carboxypeptidase decreased process quality, abnormal AB + MO1-tuba8l2 FIGURE 7 with image from Van Schoor et al., 2024
Phenotype of all Fish created by or utilizing MO1-tuba8l2
Phenotype Fish Conditions Figures
whole organism thigmotaxis decreased process quality, abnormal AB + MO1-tuba8l2 control FIGURE 3 with image,  FIGURE 5 with image from Van Schoor et al., 2024
motor neuron axon decreased length, abnormal AB + MO1-tuba8l2 control FIGURE 2 with image,  FIGURE 4 with image from Van Schoor et al., 2024
whole organism Ab16-tuba labeling decreased amount, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
whole organism alpha-tubulin acetylation decreased process quality, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
whole organism tubulin-tyrosine carboxypeptidase decreased process quality, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
whole organism Ab1-tuba4a labeling decreased amount, abnormal AB + MO1-tuba8l2 control FIGURE 2 with image from Van Schoor et al., 2024
whole organism Ab1-polyglutamate labeling decreased amount, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
whole organism tubulin-glutamic acid ligase activity decreased process quality, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
whole organism ab1-tuba labeling decreased amount, abnormal AB + MO1-tuba8l2 control FIGURE 7 with image from Van Schoor et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.