Morpholino

MO1-elf3

ID

ZDB-MRPHLNO-240119-3

Name

MO1-elf3

Previous Names

elf3-UTR-MO (1)

Target

elf3 (1)

Sequence

5' - TGTGGTGGTCAAAGATTGTTTTCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-elf3

Expressed Gene	Anatomy	Figures
col2a1a	whole organism	Fig 6 from Sarmah et al., 2022
fn1a	whole organism	Fig 6 from Sarmah et al., 2022
mmp2	whole organism	Fig 6 from Sarmah et al., 2022
mmp9	whole organism	Fig 6 from Sarmah et al., 2022
mmp13a	whole organism	Fig 6 from Sarmah et al., 2022
sox9b	cranial cartilage pectoral fin retina ventricular zone	Fig 6 from Sarmah et al., 2022

Phenotype

Phenotype resulting from MO1-elf3

Phenotype	Fish	Figures
caudal fin fibrillar collagen trimer spatial pattern, abnormal	AB + MO1-elf3	Fig 4 from Sarmah et al., 2022
ceratobranchial cartilage morphology, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
cranial cartilage sox9b expression decreased distribution, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
cranial nerve II decreased size, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
cranial nerve II structure, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
ethmoid cartilage decreased size, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
eye decreased size, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
head decreased size, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
median fin fold morphology, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
median fin fold fibrillar collagen trimer disorganized, abnormal	AB + MO1-elf3	Fig 4 from Sarmah et al., 2022
motor neuron axon decreased length, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
motor neuron axon fragmented, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
motor neuron axon increased branchiness, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
neurocranial trabecula absence of anatomical entity, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
parachordal cartilage absence of anatomical entity, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
pectoral fin sox9b expression decreased distribution, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
pericardium edematous, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
post-vent region curved, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
post-vent region kinked, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
retina sox9b expression decreased distribution, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
tectal neuropile axon decreased distribution, abnormal	AB + MO1-elf3	Fig 5 from Sarmah et al., 2022
trunk deformed, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
ventral mandibular arch protruding, abnormal	AB + MO1-elf3	Fig 3 from Sarmah et al., 2022
ventricular zone sox9b expression decreased distribution, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
whole organism decreased length, abnormal	AB + MO1-elf3	Fig 2 from Sarmah et al., 2022
whole organism mmp9 expression increased amount, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
whole organism mmp13a expression increased amount, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
whole organism mmp2 expression increased amount, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022
whole organism fn1a expression increased amount, abnormal	AB + MO1-elf3	Fig 6 from Sarmah et al., 2022

Phenotype of all Fish created by or utilizing MO1-elf3

Phenotype	Fish	Conditions	Figures
tectal neuropile axon decreased distribution, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
motor neuron axon fragmented, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
ethmoid cartilage decreased size, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
pectoral fin sox9b expression decreased distribution, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
cranial nerve II structure, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
median fin fold fibrillar collagen trimer disorganized, abnormal	AB + MO1-elf3	control	Fig 4 from Sarmah et al., 2022
ventral mandibular arch protruding, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
caudal fin fibrillar collagen trimer spatial pattern, abnormal	AB + MO1-elf3	control	Fig 4 from Sarmah et al., 2022
whole organism mmp2 expression increased amount, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
whole organism decreased length, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022
ventricular zone sox9b expression decreased distribution, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
cranial cartilage sox9b expression decreased distribution, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
neurocranial trabecula absence of anatomical entity, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
motor neuron axon decreased length, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
post-vent region curved, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022
parachordal cartilage absence of anatomical entity, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
motor neuron axon increased branchiness, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
median fin fold morphology, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022
whole organism mmp13a expression increased amount, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
whole organism fn1a expression increased amount, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
whole organism mmp9 expression increased amount, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
post-vent region kinked, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022
pericardium edematous, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022
cranial nerve II decreased size, abnormal	AB + MO1-elf3	control	Fig 5 from Sarmah et al., 2022
retina sox9b expression decreased distribution, abnormal	AB + MO1-elf3	control	Fig 6 from Sarmah et al., 2022
head decreased size, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
eye decreased size, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
ceratobranchial cartilage morphology, abnormal	AB + MO1-elf3	control	Fig 3 from Sarmah et al., 2022
trunk deformed, abnormal	AB + MO1-elf3	control	Fig 2 from Sarmah et al., 2022

Citations