Morpholino

MO1-elf3

ID
ZDB-MRPHLNO-240119-3
Name
MO1-elf3
Previous Names
  • elf3-UTR-MO (1)
Target
Sequence
5' - TGTGGTGGTCAAAGATTGTTTTCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-elf3
Phenotype
Phenotype resulting from MO1-elf3
Phenotype Fish Figures
caudal fin fibrillar collagen trimer spatial pattern, abnormal AB + MO1-elf3 Fig 4 with image from Sarmah et al., 2022
ceratobranchial cartilage morphology, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
cranial cartilage sox9b expression decreased distribution, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
cranial nerve II decreased size, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
cranial nerve II structure, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
ethmoid cartilage decreased size, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
eye decreased size, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
head decreased size, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
median fin fold morphology, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
median fin fold fibrillar collagen trimer disorganized, abnormal AB + MO1-elf3 Fig 4 with image from Sarmah et al., 2022
motor neuron axon decreased length, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
motor neuron axon fragmented, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
motor neuron axon increased branchiness, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
neurocranial trabecula absence of anatomical entity, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
parachordal cartilage absence of anatomical entity, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
pectoral fin sox9b expression decreased distribution, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
pericardium edematous, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
post-vent region curved, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
post-vent region kinked, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
retina sox9b expression decreased distribution, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
tectal neuropile axon decreased distribution, abnormal AB + MO1-elf3 Fig 5 with image from Sarmah et al., 2022
trunk deformed, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
ventral mandibular arch protruding, abnormal AB + MO1-elf3 Fig 3 with image from Sarmah et al., 2022
ventricular zone sox9b expression decreased distribution, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
whole organism decreased length, abnormal AB + MO1-elf3 Fig 2 with image from Sarmah et al., 2022
whole organism mmp13a.1 expression increased amount, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
whole organism mmp9 expression increased amount, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
whole organism mmp2 expression increased amount, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
whole organism fn1a expression increased amount, abnormal AB + MO1-elf3 Fig 6 with image from Sarmah et al., 2022
Phenotype of all Fish created by or utilizing MO1-elf3
Phenotype Fish Conditions Figures
tectal neuropile axon decreased distribution, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
motor neuron axon fragmented, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
ethmoid cartilage decreased size, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
pectoral fin sox9b expression decreased distribution, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
cranial nerve II structure, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
median fin fold fibrillar collagen trimer disorganized, abnormal AB + MO1-elf3 control Fig 4 with image from Sarmah et al., 2022
ventral mandibular arch protruding, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
caudal fin fibrillar collagen trimer spatial pattern, abnormal AB + MO1-elf3 control Fig 4 with image from Sarmah et al., 2022
whole organism mmp2 expression increased amount, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
whole organism decreased length, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
ventricular zone sox9b expression decreased distribution, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
cranial cartilage sox9b expression decreased distribution, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
neurocranial trabecula absence of anatomical entity, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
motor neuron axon decreased length, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
post-vent region curved, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
parachordal cartilage absence of anatomical entity, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
motor neuron axon increased branchiness, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
median fin fold morphology, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
whole organism fn1a expression increased amount, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
whole organism mmp9 expression increased amount, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
post-vent region kinked, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
pericardium edematous, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
cranial nerve II decreased size, abnormal AB + MO1-elf3 control Fig 5 with image from Sarmah et al., 2022
retina sox9b expression decreased distribution, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
head decreased size, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
eye decreased size, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
whole organism mmp13a.1 expression increased amount, abnormal AB + MO1-elf3 control Fig 6 with image from Sarmah et al., 2022
ceratobranchial cartilage morphology, abnormal AB + MO1-elf3 control Fig 3 with image from Sarmah et al., 2022
trunk deformed, abnormal AB + MO1-elf3 control Fig 2 with image from Sarmah et al., 2022
Citations