Morpholino

MO1-atf5b

ID
ZDB-MRPHLNO-221205-1
Name
MO1-atf5b
Previous Names
None
Target
Sequence
5' - ATCCAATCAATTTAGCCCTACGTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atf5b
Expressed Gene Anatomy Figures
ano2b Fig. 8 from Zhu et al., 2022
ascl1a Fig. 8 from Zhu et al., 2022
cntn4 Fig. 8 from Zhu et al., 2022
drd2a Fig. 8 from Zhu et al., 2022
faim2a Fig. 8 from Zhu et al., 2022
gap43 Fig. 8 from Zhu et al., 2022
gnal Fig. 8 from Zhu et al., 2022
gng13a Fig. 8 from Zhu et al., 2022
gng13b Fig. 8 from Zhu et al., 2022
neurog1 Fig. 8 from Zhu et al., 2022
ompb Fig. 8 from Zhu et al., 2022
or40a1 Fig. 8 from Zhu et al., 2022
prokr1b Fig. 8 from Zhu et al., 2022
stmn2b Fig. 8 from Zhu et al., 2022
stom Fig. 8 from Zhu et al., 2022
stxbp5a Fig. 8 from Zhu et al., 2022
umodl1 Fig. 8 from Zhu et al., 2022
Phenotype
Phenotype resulting from MO1-atf5b
Phenotype Fish Figures
whole organism gng13b expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism prokr1b expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism stxbp5a expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism stom expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism ano2b expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism cntn4 expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism gnal expression decreased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism gng13a expression increased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
whole organism neurog1 expression increased amount, abnormal AB + MO1-atf5b Fig. 8 from Zhu et al., 2022
Phenotype of all Fish created by or utilizing MO1-atf5b
Phenotype Fish Conditions Figures
whole organism ano2b expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism stxbp5a expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism gnal expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism prokr1b expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism stom expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism gng13a expression increased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism cntn4 expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism neurog1 expression increased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
whole organism gng13b expression decreased amount, abnormal AB + MO1-atf5b standard conditions Fig. 8 from Zhu et al., 2022
ciliated olfactory receptor neuron decreased amount, exacerbated AB + MO1-atf5a + MO1-atf5b standard conditions Fig. 6 from Zhu et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.