Morpholino

MO2-tcf12

ID
ZDB-MRPHLNO-210317-4
Name
MO2-tcf12
Previous Names
None
Target
Sequence
5' - TGTGTGGGACAGCATACCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tcf12
Expressed Gene Anatomy Figures
sox2 Fig. 4 from Davis et al., 2020
stub1 Fig. 4 from Davis et al., 2020
tcf3a Fig. 4 from Davis et al., 2020
tcf3b Fig. 4 from Davis et al., 2020
Phenotype
Phenotype resulting from MO2-tcf12
Phenotype Fish Figures
head tcf3a expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 Fig. 4 from Davis et al., 2020
head tcf3b expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 Fig. 4 from Davis et al., 2020
head stub1 expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 Fig. 4 from Davis et al., 2020
head sox2 expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 Fig. 4 from Davis et al., 2020
neuron EGFP expression decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
neuron EGFP expression spatial pattern, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
neuron axon ab3-gnrh labeling decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
neuron axon decreased length, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
olfactory bulb decreased size, abnormal zf103Tg/+ + MO2-tcf12 Fig. S4 from Davis et al., 2020
terminal nerve ab3-gnrh labeling decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
terminal nerve axon decreased length, abnormal zf103Tg/+ + MO2-tcf12 Fig. 3 from Davis et al., 2020
Phenotype of all Fish created by or utilizing MO2-tcf12
Phenotype Fish Conditions Figures
neuron EGFP expression spatial pattern, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
olfactory bulb decreased size, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. S4 from Davis et al., 2020
neuron EGFP expression decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
head stub1 expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 4 from Davis et al., 2020
terminal nerve ab3-gnrh labeling decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
neuron axon ab3-gnrh labeling decreased distribution, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
neuron axon decreased length, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
head tcf3b expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 4 from Davis et al., 2020
head sox2 expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 4 from Davis et al., 2020
head tcf3a expression decreased amount, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 4 from Davis et al., 2020
terminal nerve axon decreased length, abnormal zf103Tg/+ + MO2-tcf12 standard conditions Fig. 3 from Davis et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.