Morpholino

MO1-cd248b

ID
ZDB-MRPHLNO-200214-7
Name
MO1-cd248b
Previous Names
None
Target
Sequence
5' - AGAAAAGACAGGGATACACTGCACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cd248b
Expressed Gene Anatomy Figures
pax2a Fig. 6 with image from Lee et al., 2019
sox10 Fig. 6 with image from Lee et al., 2019
Phenotype
Phenotype resulting from MO1-cd248b
Phenotype Fish Figures
blastoderm morphology, abnormal AB + MO1-cd248b Fig. 8 with image from Lee et al., 2019
blastomere decreased size, abnormal AB + MO1-cd248b Fig. 8 with image from Lee et al., 2019
blastomere cell migration decreased process quality, abnormal AB + MO1-cd248b Fig. 7 with image from Lee et al., 2019
blastomere filamentous actin increased accumulation blastomere cytosol, abnormal AB + MO1-cd248b Fig. 8 with image from Lee et al., 2019
blastomere filamentous actin mislocalised, abnormal AB + MO1-cd248b Fig. 8 with image from Lee et al., 2019
blood circulation decreased linear velocity, abnormal AB + MO1-cd248b Fig. 4 with image from Lee et al., 2019
brain morphology, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
common cardinal vein decreased curvature, abnormal y1Tg + MO1-cd248b Fig. 4 with image from Lee et al., 2019
common cardinal vein decreased size, abnormal y1Tg + MO1-cd248b Fig. 4 with image from Lee et al., 2019
common cardinal vein morphology, abnormal y1Tg + MO1-cd248b Fig. 4 with image from Lee et al., 2019
common cardinal vein hemoglobin spatial pattern, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
determination of heart left/right asymmetry process quality, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
embryonic heart tube development process quality, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-cd248b Fig. 7 with image from Lee et al., 2019
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB + MO1-cd248b Fig. 8 with image from Lee et al., 2019
eye decreased size, abnormal AB + MO1-cd248b Fig. 2 with image from Lee et al., 2019
forerunner cell group absent, abnormal AB + MO1-cd248b Fig. 7 with image from Lee et al., 2019
head decreased size, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
heart edematous, abnormal AB + MO1-cd248b Fig. 2 with image from Lee et al., 2019
heart contraction process quality, abnormal AB + MO1-cd248b Fig. 5 with image,  Fig. 6 with image from Lee et al., 2019
hematopoietic system hemoglobin spatial pattern, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
intersegmental vessel decreased length, abnormal y1Tg + MO1-cd248b Fig. 4 with image from Lee et al., 2019
intersegmental vessel shortened, abnormal y1Tg + MO1-cd248b Fig. 4 with image from Lee et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
Kupffer's vesicle increased amount, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
left/right pattern formation decreased occurrence, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
left/right pattern formation process quality, abnormal AB + MO1-cd248b Fig. 5 with image from Lee et al., 2019
leukocyte decreased amount, abnormal uwm1Tg + MO1-cd248b Fig. 5 with image from Lee et al., 2019
midbrain hindbrain boundary absent, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
muscle contraction occurrence, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
neural crest sox10 expression spatial pattern, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
neuromast decreased amount, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
notochord increased width, abnormal AB + MO1-cd248b Fig. 7 with image from Lee et al., 2019
notochord shortened, abnormal AB + MO1-cd248b Fig. 7 with image from Lee et al., 2019
pericardium edematous, abnormal AB + MO1-cd248b Fig. 2 with image from Lee et al., 2019
ventricular system absent, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
ventricular system morphology, abnormal AB + MO1-cd248b Fig. 6 with image from Lee et al., 2019
whole organism curved, abnormal AB + MO1-cd248b Fig. 2 with image from Lee et al., 2019
whole organism dorsalized, abnormal AB + MO1-cd248b Fig. 2 with image from Lee et al., 2019
Phenotype of all Fish created by or utilizing MO1-cd248b
Phenotype Fish Conditions Figures
brain morphology, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
left/right pattern formation decreased occurrence, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
ventricular system absent, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
determination of heart left/right asymmetry process quality, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
hematopoietic system hemoglobin spatial pattern, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
neural crest sox10 expression spatial pattern, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
ventricular system morphology, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
blastomere cell migration decreased process quality, abnormal AB + MO1-cd248b control Fig. 7 with image from Lee et al., 2019
notochord increased width, abnormal AB + MO1-cd248b control Fig. 7 with image from Lee et al., 2019
whole organism dorsalized, abnormal AB + MO1-cd248b control Fig. 2 with image from Lee et al., 2019
blood circulation decreased linear velocity, abnormal AB + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
head decreased size, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
Kupffer's vesicle absent, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
eye decreased size, abnormal AB + MO1-cd248b control Fig. 2 with image from Lee et al., 2019
blastomere filamentous actin mislocalised, abnormal AB + MO1-cd248b control Fig. 8 with image from Lee et al., 2019
common cardinal vein hemoglobin spatial pattern, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
muscle contraction occurrence, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
midbrain hindbrain boundary absent, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
whole organism curved, abnormal AB + MO1-cd248b control Fig. 2 with image from Lee et al., 2019
blastomere decreased size, abnormal AB + MO1-cd248b control Fig. 8 with image from Lee et al., 2019
neuromast decreased amount, abnormal AB + MO1-cd248b control Fig. 6 with image from Lee et al., 2019
epiboly involved in gastrulation with mouth forming second process quality, abnormal AB + MO1-cd248b control Fig. 8 with image from Lee et al., 2019
pericardium edematous, abnormal AB + MO1-cd248b control Fig. 2 with image from Lee et al., 2019
blastomere filamentous actin increased accumulation blastomere cytosol, abnormal AB + MO1-cd248b control Fig. 8 with image from Lee et al., 2019
left/right pattern formation process quality, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
forerunner cell group absent, abnormal AB + MO1-cd248b control Fig. 7 with image from Lee et al., 2019
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB + MO1-cd248b control Fig. 7 with image from Lee et al., 2019
Kupffer's vesicle increased amount, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
heart edematous, abnormal AB + MO1-cd248b control Fig. 2 with image from Lee et al., 2019
blood coagulation decreased occurrence, abnormal AB + MO1-cd248b amputation: caudal fin Fig. 2 with image from Lee et al., 2019
heart contraction process quality, abnormal AB + MO1-cd248b control Fig. 5 with image,  Fig. 6 with image from Lee et al., 2019
embryonic heart tube development process quality, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
notochord shortened, abnormal AB + MO1-cd248b control Fig. 7 with image from Lee et al., 2019
Kupffer's vesicle decreased size, abnormal AB + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
blastoderm morphology, abnormal AB + MO1-cd248b control Fig. 8 with image from Lee et al., 2019
leukocyte decreased amount, abnormal uwm1Tg + MO1-cd248b control Fig. 5 with image from Lee et al., 2019
common cardinal vein morphology, abnormal y1Tg + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
intersegmental vessel decreased length, abnormal y1Tg + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
common cardinal vein decreased size, abnormal y1Tg + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
intersegmental vessel shortened, abnormal y1Tg + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
common cardinal vein decreased curvature, abnormal y1Tg + MO1-cd248b control Fig. 4 with image from Lee et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.