Morpholino

MO3-brd2a

ID
ZDB-MRPHLNO-170824-7
Name
MO3-brd2a
Previous Names
None
Target
Sequence
5' - GGCTAAGAGCCGTTTCCATCGGGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking morpholino targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-brd2a
Expressed Gene Anatomy Figures
brd2a Fig. 4 with image from Murphy et al., 2017
egr2b Fig. 11 with image from Murphy et al., 2017
en2a Fig. 10 with image,  Fig. 12 with image from Murphy et al., 2017
hoxa2b Fig. 11 with image from Murphy et al., 2017
hoxb1a Fig. 11 with image from Murphy et al., 2017
otx2b Fig. 11 with image from Murphy et al., 2017
pax2a Fig. 10 with image from Murphy et al., 2017
wnt1 Fig. 10 with image from Murphy et al., 2017
Phenotype
Phenotype resulting from MO3-brd2a
Phenotype Fish Figures
brain brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
brain decreased size, abnormal AB + MO3-brd2a Fig. 1 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a Fig. 6 with image from Murphy et al., 2017
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 Fig. 5 with image,  Fig. 12 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 Fig. 6 with image from Murphy et al., 2017
central nervous system apoptotic process increased occurrence, abnormal AB + MO3-brd2a Fig. 5 with image from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a Fig. 6 with image from Murphy et al., 2017
fourth ventricle collapsed, abnormal AB + MO3-brd2a Fig. 1 with image,  Fig. S1 with image from Murphy et al., 2017
gut brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
hindbrain interneuron mislocalised, abnormal AB + MO3-brd2a Fig. 14 with image from Murphy et al., 2017
hindbrain interneuron spatial pattern, abnormal AB + MO3-brd2a Fig. 14 with image from Murphy et al., 2017
mesoderm disorganized, abnormal AB + MO3-brd2a Fig. S1 with image from Murphy et al., 2017
midbrain hindbrain boundary morphology, abnormal AB + MO3-brd2a Fig. 1 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a + MO4-tp53 Fig. 10 with image,  Fig. 12 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region pax2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 10 with image from Murphy et al., 2017
notochord morphology, abnormal AB + MO3-brd2a Fig. S1 with image from Murphy et al., 2017
post-vent region morphology, abnormal AB + MO3-brd2a Fig. 1 with image from Murphy et al., 2017
pronephros brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
retinal ganglion cell brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
rhombomere 3 egr2b expression decreased distribution, abnormal AB + MO3-brd2a Fig. 11 with image from Murphy et al., 2017
somite condensed, abnormal AB + MO3-brd2a Fig. S1 with image from Murphy et al., 2017
somite brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
somite irregularly shaped, abnormal AB + MO3-brd2a Fig. S1 with image from Murphy et al., 2017
spinal cord interneuron mislocalised, abnormal AB + MO3-brd2a Fig. 14 with image from Murphy et al., 2017
spinal cord interneuron spatial pattern, abnormal AB + MO3-brd2a Fig. 14 with image from Murphy et al., 2017
spinal cord neural tube brd2a expression decreased distribution, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
whole organism brd2a expression decreased amount, abnormal AB + MO3-brd2a Fig. 4 with image from Murphy et al., 2017
whole organism apoptotic process decreased occurrence, abnormal AB + MO3-brd2a Fig. 5 with image from Murphy et al., 2017
Phenotype of all Fish created by or utilizing MO3-brd2a
Phenotype Fish Conditions Figures
pronephros brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
midbrain hindbrain boundary morphology, abnormal AB + MO3-brd2a standard conditions Fig. 1 with image from Murphy et al., 2017
notochord morphology, abnormal AB + MO3-brd2a standard conditions Fig. S1 with image from Murphy et al., 2017
brain apoptotic process occurrence, ameliorated AB + MO3-brd2a chemical treatment: apoptosis inhibitor Fig. 12 with image from Murphy et al., 2017
whole organism brd2a expression decreased amount, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a standard conditions Fig. 6 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 10 with image,  Fig. 12 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a standard conditions Fig. 6 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region pax2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 10 with image from Murphy et al., 2017
spinal cord interneuron spatial pattern, abnormal AB + MO3-brd2a standard conditions Fig. 14 with image from Murphy et al., 2017
brain brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
brain decreased size, abnormal AB + MO3-brd2a standard conditions Fig. 1 with image from Murphy et al., 2017
gut brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a chemical treatment: apoptosis inhibitor Fig. 12 with image from Murphy et al., 2017
retinal ganglion cell brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
whole organism apoptotic process decreased occurrence, abnormal AB + MO3-brd2a standard conditions Fig. 5 with image from Murphy et al., 2017
hindbrain interneuron spatial pattern, abnormal AB + MO3-brd2a standard conditions Fig. 14 with image from Murphy et al., 2017
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a standard conditions Fig. 5 with image,  Fig. 12 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a standard conditions Fig. 6 with image from Murphy et al., 2017
mesoderm disorganized, abnormal AB + MO3-brd2a standard conditions Fig. S1 with image from Murphy et al., 2017
somite condensed, abnormal AB + MO3-brd2a standard conditions Fig. S1 with image from Murphy et al., 2017
somite irregularly shaped, abnormal AB + MO3-brd2a standard conditions Fig. S1 with image from Murphy et al., 2017
somite brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
spinal cord neural tube brd2a expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 4 with image from Murphy et al., 2017
fourth ventricle collapsed, abnormal AB + MO3-brd2a standard conditions Fig. 1 with image,  Fig. S1 with image from Murphy et al., 2017
spinal cord interneuron mislocalised, abnormal AB + MO3-brd2a standard conditions Fig. 14 with image from Murphy et al., 2017
central nervous system apoptotic process increased occurrence, abnormal AB + MO3-brd2a standard conditions Fig. 5 with image from Murphy et al., 2017
post-vent region morphology, abnormal AB + MO3-brd2a standard conditions Fig. 1 with image from Murphy et al., 2017
hindbrain interneuron mislocalised, abnormal AB + MO3-brd2a standard conditions Fig. 14 with image from Murphy et al., 2017
rhombomere 3 egr2b expression decreased distribution, abnormal AB + MO3-brd2a standard conditions Fig. 11 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a + MO4-brd2a standard conditions Table 1 from Murphy et al., 2017
central nervous system cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain cell death increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain structure, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 6 with image from Murphy et al., 2017
brain apoptotic process increased occurrence, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
midbrain hindbrain boundary posterior region en2a expression decreased distribution, abnormal AB + MO3-brd2a + MO4-tp53 standard conditions Fig. 12 with image from Murphy et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.