Morpholino

MO4-mir145

ID

ZDB-MRPHLNO-170327-5

Name

MO4-mir145

Previous Names

None

Target

Sequence

5' - GAATCCCCCTTTCGATTGCCCAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-mir145

Phenotype

Phenotype resulting from MO4-mir145

Phenotype	Fish	Figures
gut peristalsis decreased occurrence, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cdh1 expression decreased amount, abnormal	uto5Tg + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cdh2 expression increased amount, abnormal	uto5Tg + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal	s854Tg; uto5Tg + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell disorganized, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell morphology, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell shape, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
smooth muscle cell cell maturation decreased occurrence, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
whole organism foxo1a expression increased amount, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017
whole organism zeb1a expression increased amount, abnormal	WT + MO4-mir145	Fig. 6 from Gays et al., 2017

Phenotype of all Fish created by or utilizing MO4-mir145

Phenotype	Fish	Conditions	Figures
whole organism zeb1a expression increased amount, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell morphology, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
whole organism foxo1a expression increased amount, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
smooth muscle cell cell maturation decreased occurrence, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
gut peristalsis decreased occurrence, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell disorganized, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell shape, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal	WT + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cdh2 expression increased amount, abnormal	uto5Tg + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cdh1 expression decreased amount, abnormal	uto5Tg + MO4-mir145	control	Fig. 6 from Gays et al., 2017
intestine smooth muscle cell decreased amount, abnormal	s854Tg; uto5Tg + MO4-mir145	control	Fig. 6 from Gays et al., 2017

Citations