Morpholino

MO1-ninl

ID
ZDB-MRPHLNO-170227-3
Name
MO1-ninl
Previous Names
None
Target
Sequence
5' - CATCCTCGTCCATCCCACCACATAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ninl
Expressed Gene Anatomy Figures
cc2d2a Fig. 2 with image from Bachmann-Gagescu et al., 2015
ush2a Fig. 6 with image from Dona et al., 2015
Phenotype
Phenotype resulting from MO1-ninl
Phenotype Fish Figures
eye decreased size, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vesicle, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vacuole, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO1-ninl Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell Ab1-rab8a labeling decreased distribution, abnormal WT + MO1-ninl Fig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO1-ninl Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell axoneme decreased length, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
Fig. S9 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-ninl Fig. 3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment structure, abnormal WT + MO1-ninl Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell protein localization disrupted, abnormal WT + MO1-ninl Fig. 3 with image,  Fig. 5 with image from Bachmann-Gagescu et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal WT + MO1-ninl Fig. S4 with image from Bachmann-Gagescu et al., 2015
Fig. 3 with image from Dona et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal WT + MO1-ninl Fig. 3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal WT + MO1-ninl Fig. S3 with image from Bachmann-Gagescu et al., 2015
ventricular system dilated, abnormal WT + MO1-ninl Fig. S3 with image from Bachmann-Gagescu et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl Fig. 3 with image from Dona et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-ninl Fig. S3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
Phenotype of all Fish created by or utilizing MO1-ninl
Phenotype Fish Conditions Figures
melanosome transport delayed, abnormal TL + MO1-ninl chemical treatment: (R)-adrenaline Fig. 7 with image from Dona et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl control Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell ush2a expression decreased distribution, abnormal TL + MO1-ninl control Fig. 6 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment malformed, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
optokinetic behavior decreased process quality, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vacuole, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal TL + MO1-ninl control Fig. S9 with image from Dona et al., 2015
eye decreased size, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Ab2-ninl labeling decreased distribution, abnormal TL + MO1-ninl control Fig. 6 with image from Dona et al., 2015
ventricular system dilated, abnormal WT + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-ninl standard conditions Fig. 3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal WT + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
pericardium edematous, abnormal WT + MO1-ninl standard conditions Fig. S4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment structure, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell axoneme decreased length, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vesicle, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell protein localization disrupted, abnormal WT + MO1-ninl control Fig. 3 with image,  Fig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal WT + MO1-ninl standard conditions Fig. 3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-ninl standard conditions Fig. S3 with image,  Fig. S4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell Ab1-rab8a labeling decreased distribution, abnormal WT + MO1-ninl control Fig. 5 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell accumulation eye photoreceptor cell vacuole, abnormal WT + MO1-ninl standard conditions Fig. 3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell cell body ab5-rho labeling mislocalised, abnormal WT + MO1-ninl control Fig. 3 with image from Bachmann-Gagescu et al., 2015
pronephros cystic, abnormal li1Tg + MO1-ninl control Fig. S3 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell ab5-rho labeling mislocalised, abnormal cc2d2aw38/w38 + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell protein localization disrupted, abnormal cc2d2aw38/w38 + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
whole organism anterior-posterior axis decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-dync1h1 + MO1-ninl control Fig. 5 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment has extra parts of type eye photoreceptor cell lysosome, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
whole organism anterior-posterior axis curved ventral, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
photoreceptor cell outer segment organization disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
post-vent region increased curvature, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell vacuolated, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi apparatus swollen, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
swimming disrupted, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor inner segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor disc membrane deformed, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell lacks parts or has fewer parts of type eye photoreceptor cell photoreceptor outer segment, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment has extra parts of type eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment morphology, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
pericardium edematous, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor inner segment accumulation eye photoreceptor cell vesicle, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell photoreceptor outer segment decreased length, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 3 with image,  Fig. 4 with image from Dona et al., 2015
eye photoreceptor cell Golgi stack distended, abnormal TL + MO1-ninl + MO2-dzank1 control Fig. 4 with image from Dona et al., 2015
pronephros cystic, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
pronephric glomerulus dilated, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
pronephric duct dilated, abnormal cc2d2aw38/w38; li1Tg + MO1-ninl control Fig. 4 with image from Bachmann-Gagescu et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.