Morpholino

MO1-smad9

ID
ZDB-MRPHLNO-140620-6
Name
MO1-smad9
Previous Names
None
Target
Sequence
5' - TCGTGAGACGGGTTGATTTTAAATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smad9
Expressed Gene Anatomy Figures
cyp26a1 Fig. 4 from Wei et al., 2014
foxi1 Fig. 4 from Wei et al., 2014
lcp1 Fig. 7 from Wei et al., 2014
mpx Fig. 7 from Wei et al., 2014
smad1 Fig. 5 from Wei et al., 2014
smad9 Fig. 5 from Wei et al., 2014
szl Fig. 4 from Wei et al., 2014
Phenotype
Phenotype resulting from MO1-smad9
Phenotype Fish Figures
blood vasculature misrouted, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
blood vessel morphogenesis disrupted, abnormal zf531Tg + MO1-smad9 Fig. 4 with image,  Fig. 6 with image from Walcott et al., 2018
brain vasculature lacks parts or has fewer parts of type central artery, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
caudal vein plexus decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
central nervous system degenerate, abnormal WT + MO1-smad9 Fig. 3 from Wei et al., 2014
dorsal longitudinal vein attached to mesencephalic artery, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic vein, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
eye decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
granulocyte decreased amount, abnormal WT + MO1-smad9 Fig. 7 from Wei et al., 2014
head decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
intersegmental vessel has extra parts of type angiogenic sprout, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta increased diameter, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
lateral dorsal aorta shape, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
macrophage decreased amount, abnormal WT + MO1-smad9 Fig. 7 from Wei et al., 2014
pericardium edematous, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
trunk decreased width, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
Phenotype of all Fish created by or utilizing MO1-smad9
Phenotype Fish Conditions Figures
macrophage decreased amount, abnormal WT + MO1-smad9 standard conditions Fig. 7 from Wei et al., 2014
central nervous system degenerate, abnormal WT + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
granulocyte decreased amount, abnormal WT + MO1-smad9 standard conditions Fig. 7 from Wei et al., 2014
blood vasculature misrouted, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
head decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
trunk decreased width, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
blood vessel morphogenesis disrupted, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image,  Fig. 6 with image from Walcott et al., 2018
intersegmental vessel has extra parts of type angiogenic sprout, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta shape, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
pericardium edematous, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
brain vasculature lacks parts or has fewer parts of type central artery, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
caudal vein plexus decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic vein, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta increased diameter, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
eye decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic artery, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
whole organism wholly dorsalized, abnormal WT + MO1-smad5 + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal WT + MO1-smad5 + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal WT + MO1-smad9 + MO3-smad1 standard conditions Fig. 4 from Wei et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-smad9 + MO3-smad1 standard conditions Fig. 4 from Wei et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.