Morpholino

MO1-flt3

ID

ZDB-MRPHLNO-140603-1

Name

MO1-flt3

Previous Names

Target

Sequence

5' - GCGTGAATACATAACAGTTTGTTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-flt3

Expressed Gene	Anatomy	Figures
csf1ra	macrophage	Fig. S6 from He et al., 2014
efnb2a	artery dorsal aorta	Fig. 3 from He et al., 2014
flt4	vein	Fig. 3 from He et al., 2014
gata1a	intermediate cell mass of mesoderm	Fig. S6 from He et al., 2014
hbae1.1	intermediate cell mass of mesoderm	Fig. S6 from He et al., 2014
lcp1	ball anterior region leukocyte	Fig. 2, Fig. S6 from He et al., 2014
lmo2	anterior lateral plate mesoderm	Fig. S6 from He et al., 2014
mpeg1.1	macrophage	Fig. S6 from He et al., 2014
mpx	granulocyte	Fig. S6 from He et al., 2014
myb	caudal hematopoietic tissue head kidney hematopoietic system intermediate cell mass of mesoderm ventral wall of dorsal aorta	Fig. 5 from Peng et al., 2015 Fig. 2, Fig. 3 from He et al., 2014
rag1	thymus	Fig. 2, Fig. 3 from He et al., 2014
spi1b	ball anterior region common myeloid progenitor	Fig. S6 from He et al., 2014
tal1	anterior lateral plate mesoderm	Fig. S6 from He et al., 2014

Phenotype

Phenotype resulting from MO1-flt3

Phenotype	Fish	Figures
caudal hematopoietic tissue myb expression decreased amount, abnormal	TU + MO1-flt3	Fig. 5 from Peng et al., 2015
head kidney myb expression decreased amount, abnormal	TU + MO1-flt3	Fig. 5 from Peng et al., 2015

Phenotype of all Fish created by or utilizing MO1-flt3

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue myb expression decreased amount, abnormal	TU + MO1-flt3	standard conditions	Fig. 5 from Peng et al., 2015
head kidney myb expression decreased amount, abnormal	TU + MO1-flt3	standard conditions	Fig. 5 from Peng et al., 2015
caudal hematopoietic tissue myb expression decreased amount, abnormal	cbl^rj32/rj32 + MO1-flt3 (TU)	chemical treatment by environment: midostaurin	Fig. 5 from Peng et al., 2015
caudal hematopoietic tissue myb expression decreased amount, abnormal	cbl^rj32/rj32 + MO1-flt3 (TU)	standard conditions	Fig. 5 from Peng et al., 2015
head kidney myb expression decreased amount, abnormal	cbl^rj32/rj32 + MO1-flt3 (TU)	chemical treatment by environment: midostaurin	Fig. 5 from Peng et al., 2015
head kidney myb expression decreased amount, abnormal	cbl^rj32/rj32 + MO1-flt3 (TU)	standard conditions	Fig. 5 from Peng et al., 2015

Citations