Morpholino

MO1-ngfrb

ID

ZDB-MRPHLNO-140522-2

Name

MO1-ngfrb

Previous Names

Target

Sequence

5' - AAGACGGTGGTCCTGGATGAAGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ngfrb

No data available

Phenotype

Phenotype resulting from MO1-ngfrb

Phenotype	Fish	Figures
anterior lateral line neuromast decreased amount, abnormal	WT + MO1-ngfrb	Fig. 2 from Han et al., 2014
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-ngfrb	Fig. 2 from Han et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO1-ngfrb	Fig. 7 from Han et al., 2014
posterior lateral line primordium decreased size, abnormal	zf106Tg + MO1-ngfrb	Fig. 6 , Fig. 7 , Fig. 8 from Han et al., 2014
posterior lateral line primordium disorganized, abnormal	zf106Tg + MO1-ngfrb	Fig. 7 from Han et al., 2014
posterior lateral line primordium lacks parts or has fewer parts of type protoneuromast, abnormal	zf106Tg + MO1-ngfrb	Fig. 7 from Han et al., 2014
pronephros proximal region slc20a1a expression decreased amount, abnormal	WT + MO1-ngfrb	Fig. 4 from F�dou et al., 2020

Phenotype of all Fish created by or utilizing MO1-ngfrb

Phenotype	Fish	Conditions	Figures
posterior lateral line primordium decreased size, abnormal	WT + MO1-ngfrb	standard conditions	Fig. 6 , Fig. 8 from Han et al., 2014
anterior lateral line neuromast decreased amount, abnormal	WT + MO1-ngfrb	standard conditions	Fig. 2 from Han et al., 2014
pronephros proximal region slc20a1a expression decreased amount, abnormal	WT + MO1-ngfrb	control	Fig. 4 from F�dou et al., 2020
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-ngfrb	standard conditions	Fig. 2 from Han et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO1-ngfrb	standard conditions	Fig. 7 from Han et al., 2014
posterior lateral line primordium disorganized, abnormal	zf106Tg + MO1-ngfrb	standard conditions	Fig. 7 from Han et al., 2014
posterior lateral line primordium decreased size, abnormal	zf106Tg + MO1-ngfrb	standard conditions	Fig. 6 , Fig. 7 from Han et al., 2014
posterior lateral line primordium lacks parts or has fewer parts of type protoneuromast, abnormal	zf106Tg + MO1-ngfrb	standard conditions	Fig. 7 from Han et al., 2014

Citations