Morpholino

MO1-wtap

ID

ZDB-MRPHLNO-140428-2

Name

MO1-wtap

Previous Names

None

Target

Sequence

5' - AGGTTCTTCATTGGTCATTCTGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wtap

Expressed Gene	Anatomy	Figures
gsc	presumptive shield	Fig. S6 from Ping et al., 2014
myod1	somite	Fig. 4 from Ping et al., 2014

Phenotype

Phenotype resulting from MO1-wtap

Phenotype	Fish	Figures
apoptotic process increased process quality, abnormal	WT + MO1-wtap	Fig. 2 from Ping et al., 2014
eye decreased size, abnormal	WT + MO1-wtap	Fig. 2 from Ping et al., 2014
head decreased size, abnormal	WT + MO1-wtap	Fig. 2 from Ping et al., 2014
notochord curved ventral, abnormal	WT + MO1-wtap	Fig. 2 from Ping et al., 2014
somite myod1 expression increased amount, abnormal	WT + MO1-wtap	Fig. 4 from Ping et al., 2014
ventricular system decreased size, abnormal	WT + MO1-wtap	Fig. 2 from Ping et al., 2014

Phenotype of all Fish created by or utilizing MO1-wtap

Phenotype	Fish	Conditions	Figures
ventricular system decreased size, abnormal	WT + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
eye decreased size, abnormal	WT + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
head decreased size, abnormal	WT + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
notochord curved ventral, abnormal	WT + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
somite myod1 expression increased amount, abnormal	WT + MO1-wtap	standard conditions	Fig. 4 from Ping et al., 2014
apoptotic process increased process quality, abnormal	WT + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
head decreased size, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
eye decreased size, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
notochord curved ventral, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
somite myod1 expression increased amount, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 4 from Ping et al., 2014
ventricular system decreased size, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014
apoptotic process increased process quality, abnormal	WT + MO1-mettl3 + MO1-wtap	standard conditions	Fig. 2 from Ping et al., 2014

Citations