Morpholino

MO3-hspb12

ID

ZDB-MRPHLNO-140128-4

Name

MO3-hspb12

Previous Names

Target

Sequence

5' - CTAGCCACATAAAATCTCGACCTTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-hspb12

Expressed Gene	Anatomy	Figures
foxa3	gut liver pancreatic bud	Fig. 6 from Lahvic et al., 2013
lft1	(not) diencephalon	Fig. 5 from Lahvic et al., 2013
lft2	heart primordium left side	Fig. 5 from Lahvic et al., 2013
myl7	atrium cardiac ventricle	Fig. 6 from Lahvic et al., 2013
pitx2	lateral plate mesoderm left side	Fig. 5 from Lahvic et al., 2013
spaw	lateral plate mesoderm left side	Fig. 5 from Lahvic et al., 2013

Phenotype

Phenotype resulting from MO3-hspb12

Phenotype	Fish	Figures
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO3-hspb12	Fig. 6 from Lahvic et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal	WT + MO3-hspb12	Fig. 6 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb12	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb12	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb12	Fig. 3 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb12	Fig. 5 , Fig. 6 from Lahvic et al., 2013

Phenotype of all Fish created by or utilizing MO3-hspb12

Phenotype	Fish	Conditions	Figures
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb12	standard conditions	Fig. 3 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb12	standard conditions	Fig. 5 , Fig. 6 from Lahvic et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal	WT + MO3-hspb12	standard conditions	Fig. 6 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb12	standard conditions	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb12	standard conditions	Fig. 3 from Lahvic et al., 2013
determination of digestive tract left/right asymmetry process quality, abnormal	WT + MO3-hspb12	standard conditions	Fig. 6 from Lahvic et al., 2013
heart rudiment displaced to whole organism right side, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
heart rudiment displaced to whole organism axis, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
heart jogging process quality, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 3 from Lahvic et al., 2013
left/right pattern formation process quality, abnormal	WT + MO3-hspb12 + MO3-hspb7	standard conditions	Fig. 5 from Lahvic et al., 2013

Citations