Morpholino

MO3-gdf3

ID
ZDB-MRPHLNO-140117-1
Name
MO3-gdf3
Previous Names
  • Dvr1 AUG MO (1)
Target
Sequence
5' - CTCTGAGGAGGACCAAGAACATTAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-gdf3
Expressed Gene Anatomy Figures
dand5 Fig. 4 with image from Peterson et al., 2013
lft1 Fig. 1 with image from Peterson et al., 2013
lft2 Fig. 1 with image from Peterson et al., 2013
myl7 Fig. 1 with image from Peterson et al., 2013
myod1 Fig. 1 with image from Peterson et al., 2013
spaw Fig. 1 with image,  Fig. 4 with image from Peterson et al., 2013
Phenotype
Phenotype resulting from MO3-gdf3
Phenotype Fish Figures
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
determination of left/right asymmetry in diencephalon decreased process quality, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
diencephalon bilateral symmetry, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
heart bilateral symmetry, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
heart looping decreased process quality, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
heart tube bilateral symmetry, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO3-gdf3 Fig. 4 with image from Peterson et al., 2013
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO3-gdf3 Fig. 1 with image from Peterson et al., 2013
Phenotype of all Fish created by or utilizing MO3-gdf3
Phenotype Fish Conditions Figures
heart looping decreased process quality, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
heart bilateral symmetry, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
determination of left/right asymmetry in diencephalon decreased process quality, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
heart tube bilateral symmetry, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO3-gdf3 standard conditions Fig. 4 with image from Peterson et al., 2013
diencephalon bilateral symmetry, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal WT + MO3-gdf3 standard conditions Fig. 1 with image from Peterson et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.