Morpholino

MO1-marcksb

ID

ZDB-MRPHLNO-130809-8

Name

MO1-marcksb

Previous Names

MAT (1)

Target

marcksb (1)

Sequence

5' - TTTTGGAGATTTGTGCTCCCATGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-marcksb

Expressed Gene	Anatomy	Figures
chrd	shield	Fig 1 from Ye et al., 2019
eve1	margin ventral region	Fig 1 from Ye et al., 2019
foxi1	non neural ectoderm	Fig 1 , Fig 8 from Ye et al., 2019
hsp70.3	whole organism	Fig 7 from Ye et al., 2019
marcksb	whole organism	Fig 7 from Ye et al., 2019
marcksl1a	whole organism	Fig 7 from Ye et al., 2019
marcksl1b	whole organism	Fig 7 from Ye et al., 2019
otx2b	neuroectoderm	Fig 1 , Fig 8 from Ye et al., 2019
szl	whole organism ventral region	Fig 2 , Fig 6 , Fig 8 from Ye et al., 2019
ved	whole organism ventral region	Fig 2 , Fig 6 , Fig 8 from Ye et al., 2019

Phenotype

Phenotype resulting from MO1-marcksb

Phenotype	Fish	Figures
BMP signaling pathway decreased occurrence, abnormal	AB + MO1-marcksb	Fig 2 from Ye et al., 2019
brain morphology, abnormal	WT + MO1-marcksb	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal	WT + MO1-marcksb	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
cell lacks parts or has fewer parts of type cell filopodium, abnormal	WT + MO1-marcksb	Fig. 6 from Wang et al., 2013
cell filamentous actin disorganized, abnormal	WT + MO1-marcksb	Fig. 6 from Wang et al., 2013
convergent extension involved in gastrulation process quality, abnormal	WT + MO1-marcksb	Fig. 6 from Wang et al., 2013
epiboly involved in gastrulation with mouth forming second process quality, abnormal	AB + MO1-marcksb	Fig 5 from Ye et al., 2019
eye morphology, abnormal	WT + MO1-marcksb	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
gastrulation process quality, abnormal	WT + MO1-marcksb	Fig. 6 from Wang et al., 2013
margin ventral region eve1 expression decreased distribution, abnormal	AB + MO1-marcksb	Fig 1 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-marcksb	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-marcksb	Fig 1 , Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-marcksb	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-marcksb	Fig 1 , Fig 8 from Ye et al., 2019
post-vent region curved, abnormal	WT + MO1-marcksb + MO4-tp53	Fig. 6 from Ott et al., 2011
post-vent region decreased length, abnormal	WT + MO1-marcksb	Fig. 3, Fig. 5 from Ott et al., 2011
shield chrd expression increased distribution, abnormal	AB + MO1-marcksb	Fig 1 from Ye et al., 2019
whole organism curved, abnormal	WT + MO1-marcksb	Fig. 3, Fig. 5 from Ott et al., 2011
whole organism dead, abnormal	WT + MO1-marcksb	Fig. 5 from Ott et al., 2011
whole organism marcksb expression decreased amount, abnormal	AB + MO1-marcksb	Fig 7 from Ye et al., 2019
whole organism hsp70.3 expression decreased amount, abnormal	AB + MO1-marcksb	Fig 7 from Ye et al., 2019
whole organism dorsalized, abnormal	AB + MO1-marcksb	Fig 1 from Ye et al., 2019
whole organism spindle-shaped, abnormal	AB + MO1-marcksb	Fig 1 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-marcksb	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-marcksb	Fig 8 from Ye et al., 2019
whole organism ventral region Ab13-smad labeling decreased amount, abnormal	AB + MO1-marcksb	Fig 2 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-marcksb	Fig 2 , Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-marcksb	Fig 2 , Fig 8 from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-marcksb	Fig 6 from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-marcksb	Fig 6 from Ye et al., 2019

Phenotype of all Fish created by or utilizing MO1-marcksb

Phenotype	Fish	Conditions	Figures
whole organism ventral region szl expression increased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-marcksb	standard conditions	Fig 6 from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-marcksb	standard conditions	Fig 6 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
margin ventral region eve1 expression decreased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
BMP signaling pathway decreased occurrence, abnormal	AB + MO1-marcksb	standard conditions	Fig 2 from Ye et al., 2019
whole organism hsp70.3 expression decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 7 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 2 , Fig 8 from Ye et al., 2019
whole organism dorsalized, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 from Ye et al., 2019
whole organism ventral region Ab13-smad labeling decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 2 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 , Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 2 , Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 , Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism marcksb expression decreased amount, abnormal	AB + MO1-marcksb	standard conditions	Fig 7 from Ye et al., 2019
shield chrd expression increased distribution, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 from Ye et al., 2019
whole organism spindle-shaped, abnormal	AB + MO1-marcksb	standard conditions	Fig 1 from Ye et al., 2019
epiboly involved in gastrulation with mouth forming second process quality, abnormal	AB + MO1-marcksb	standard conditions	Fig 5 from Ye et al., 2019
post-vent region curved, abnormal	WT + MO1-marcksb	standard conditions	Fig. 6 from Ott et al., 2011
convergent extension involved in gastrulation process quality, abnormal	WT + MO1-marcksb	standard conditions	Fig. 6 from Wang et al., 2013
brain morphology, abnormal	WT + MO1-marcksb	standard conditions	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
eye morphology, abnormal	WT + MO1-marcksb	standard conditions	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
cell lacks parts or has fewer parts of type cell filopodium, abnormal	WT + MO1-marcksb	standard conditions	Fig. 6 from Wang et al., 2013
cell filamentous actin disorganized, abnormal	WT + MO1-marcksb	standard conditions	Fig. 6 from Wang et al., 2013
post-vent region decreased length, abnormal	WT + MO1-marcksb	standard conditions	Fig. 3, Fig. 5 from Ott et al., 2011
whole organism curved, abnormal	WT + MO1-marcksb	standard conditions	Fig. 3, Fig. 5 from Ott et al., 2011
gastrulation process quality, abnormal	WT + MO1-marcksb	standard conditions	Fig. 6 from Wang et al., 2013
brain development disrupted, abnormal	WT + MO1-marcksb	standard conditions	Fig. 3, Fig. 5, Fig. 6 from Ott et al., 2011
whole organism dead, abnormal	WT + MO1-marcksb	standard conditions	Fig. 5 from Ott et al., 2011
eye morphology, abnormal	WT + MO1-marcksb + MO4-tp53	standard conditions	Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal	WT + MO1-marcksb + MO4-tp53	standard conditions	Fig. 6 from Ott et al., 2011
brain morphology, abnormal	WT + MO1-marcksb + MO4-tp53	standard conditions	Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal	WT + MO1-marcksb + MO4-tp53	standard conditions	Fig. 6 from Ott et al., 2011
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism spindle-shaped, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019

Citations