Morpholino

MO1-rpl22

ID

ZDB-MRPHLNO-130422-1

Name

MO1-rpl22

Previous Names

None

Target

Sequence

5' - CCGACAGTTTTGGCAGAAAGCCAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rpl22

Expressed Gene	Anatomy	Figures
ikzf1	common lymphoid progenitor	Fig. 3 from Zhang et al., 2013
lck	(not) pro-T cell (not) T cell	Fig. 3 from Zhang et al., 2013
myb	ventral wall of dorsal aorta hematopoietic stem cell	Fig. 7 from Zhang et al., 2013
rag1	common lymphoid progenitor	Fig. 3 from Zhang et al., 2013
runx1	ventral wall of dorsal aorta hematopoietic stem cell	Fig. 7 from Zhang et al., 2013
trbc2	(not) alpha-beta T cell (not) T cell	Fig. 3 from Zhang et al., 2013

Phenotype

Phenotype resulting from MO1-rpl22

Phenotype	Fish	Figures
alpha-beta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22	Fig. 3 from Zhang et al., 2013
alpha-beta T cell differentiation arrested, abnormal	WT + MO1-rpl22	Fig. 3 from Zhang et al., 2013
T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	WT + MO1-rpl22	Fig. 2 , Fig. 3 from Zhang et al., 2013
thymus apoptotic process increased occurrence, abnormal	cz2Tg + MO1-rpl22	Fig. 2 from Zhang et al., 2013

Phenotype of all Fish created by or utilizing MO1-rpl22

Phenotype	Fish	Conditions	Figures
alpha-beta T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22	standard conditions	Fig. 3 from Zhang et al., 2013
T cell aplastic/hypoplastic, abnormal	WT + MO1-rpl22	standard conditions	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	WT + MO1-rpl22	standard conditions	Fig. 3 from Zhang et al., 2013
alpha-beta T cell differentiation arrested, abnormal	WT + MO1-rpl22	standard conditions	Fig. 3 from Zhang et al., 2013
T cell differentiation arrested, abnormal	cz2Tg + MO1-rpl22	standard conditions	Fig. 2 from Zhang et al., 2013
thymus apoptotic process increased occurrence, abnormal	cz2Tg + MO1-rpl22	standard conditions	Fig. 2 from Zhang et al., 2013
mRNA cis splicing, via spliceosome process quality, ameliorated	WT + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 2, Fig. 7 from Zhang et al., 2017
convergent extension involved in axis elongation occurrence, ameliorated	WT + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, ameliorated	WT + MO1-hnrnpa1b + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 7 from Zhang et al., 2017

Citations