Morpholino

MO6-egr1

ID

ZDB-MRPHLNO-130327-8

Name

MO6-egr1

Previous Names

egr1sMO (1)

Target

egr1 (1)

Sequence

5' - AAGAGGGATTTAGTGCTTACCTCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-egr1

Expressed Gene	Anatomy	Figures
cdk5r1b	retinal ganglion cell layer retinal inner nuclear layer basal region	Fig. 5 from Zhang et al., 2014
ptf1a	ciliary marginal zone retina retinal inner nuclear layer	Fig. 8 from Zhang et al., 2013

Phenotype

Phenotype resulting from MO6-egr1

Phenotype	Fish	Figures
amacrine cell poorly differentiated, abnormal	AB + MO6-egr1	Fig. 4 from Zhang et al., 2013
amacrine cell differentiation decreased process quality, abnormal	AB + MO6-egr1	Fig. 4 from Zhang et al., 2013
camera-type eye photoreceptor cell differentiation delayed, abnormal	AB + MO6-egr1	Fig. 7 from Zhang et al., 2013
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal	AB + MO6-egr1	Fig. 3 , Fig. 8 from Zhang et al., 2013
eye decreased size, abnormal	AB + MO6-egr1	Fig. 2 from Zhang et al., 2013
Muller cell poorly differentiated, abnormal	AB + MO6-egr1	Fig. 4 from Zhang et al., 2013
neural retina development decreased process quality, abnormal	AB + MO6-egr1	Fig. 4 from Zhang et al., 2013
retinal bipolar neuron poorly differentiated, abnormal	AB + MO6-egr1	Fig. 4 from Zhang et al., 2013
retinal cone cell undifferentiated, abnormal	AB + MO6-egr1	Fig. 7 from Zhang et al., 2013
retinal ganglion cell dendrite morphogenesis decreased occurrence, abnormal	AB + MO6-egr1	Fig. 5 from Zhang et al., 2013
retinal inner nuclear layer has fewer parts of type retinal inner nuclear layer horizontal cell, abnormal	AB + MO6-egr1	Fig. 6 from Zhang et al., 2013
retinal inner nuclear layer physical object quality, abnormal	AB + MO6-egr1	Fig. 8 from Zhang et al., 2013
retinal inner nuclear layer poorly differentiated, abnormal	AB + MO6-egr1	Fig. 3 from Zhang et al., 2013
retinal inner plexiform layer decreased thickness, abnormal	AB + MO6-egr1	Fig. 3 , Fig. 5 from Zhang et al., 2013
retinal inner plexiform layer has fewer parts of type retinal ganglion cell dendrite, abnormal	AB + MO6-egr1	Fig. 5 from Zhang et al., 2013
retinal inner plexiform layer malformed, abnormal	AB + MO6-egr1	Fig. 3 from Zhang et al., 2013
retinal neural layer decreased size, abnormal	AB + MO6-egr1	Fig. 3 from Zhang et al., 2013
retinal outer nuclear layer poorly differentiated, abnormal	AB + MO6-egr1	Fig. 3 from Zhang et al., 2013
retinal outer plexiform layer decreased thickness, abnormal	AB + MO6-egr1	Fig. 3 from Zhang et al., 2013
retinal rod cell undifferentiated, abnormal	AB + MO6-egr1	Fig. 7 from Zhang et al., 2013
trunk decreased length, abnormal	AB + MO6-egr1	Fig. 2 from Zhang et al., 2013

Phenotype of all Fish created by or utilizing MO6-egr1

Phenotype	Fish	Conditions	Figures
retinal rod cell undifferentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 7 from Zhang et al., 2013
camera-type eye photoreceptor cell differentiation delayed, abnormal	AB + MO6-egr1	standard conditions	Fig. 7 from Zhang et al., 2013
Muller cell poorly differentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 4 from Zhang et al., 2013
neural retina development decreased process quality, abnormal	AB + MO6-egr1	standard conditions	Fig. 4 from Zhang et al., 2013
eye decreased size, abnormal	AB + MO6-egr1	standard conditions	Fig. 2 from Zhang et al., 2013
retinal ganglion cell dendrite morphogenesis decreased occurrence, abnormal	AB + MO6-egr1	standard conditions	Fig. 5 from Zhang et al., 2013
retinal inner plexiform layer decreased thickness, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 , Fig. 5 from Zhang et al., 2013
retinal inner nuclear layer physical object quality, abnormal	AB + MO6-egr1	standard conditions	Fig. 8 from Zhang et al., 2013
trunk decreased length, abnormal	AB + MO6-egr1	standard conditions	Fig. 2 from Zhang et al., 2013
retinal inner plexiform layer has fewer parts of type retinal ganglion cell dendrite, abnormal	AB + MO6-egr1	standard conditions	Fig. 5 from Zhang et al., 2013
retinal cone cell undifferentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 7 from Zhang et al., 2013
retinal outer nuclear layer poorly differentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 from Zhang et al., 2013
amacrine cell poorly differentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 4 from Zhang et al., 2013
amacrine cell differentiation decreased process quality, abnormal	AB + MO6-egr1	standard conditions	Fig. 4 from Zhang et al., 2013
retinal inner nuclear layer has fewer parts of type retinal inner nuclear layer horizontal cell, abnormal	AB + MO6-egr1	standard conditions	Fig. 6 from Zhang et al., 2013
retinal inner plexiform layer malformed, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 from Zhang et al., 2013
retinal neural layer decreased size, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 from Zhang et al., 2013
retinal inner nuclear layer poorly differentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 from Zhang et al., 2013
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 , Fig. 8 from Zhang et al., 2013
retinal bipolar neuron poorly differentiated, abnormal	AB + MO6-egr1	standard conditions	Fig. 4 from Zhang et al., 2013
retinal outer plexiform layer decreased thickness, abnormal	AB + MO6-egr1	standard conditions	Fig. 3 from Zhang et al., 2013

Citations