Morpholino

MO1-popdc1

ID
ZDB-MRPHLNO-130104-1
Name
MO1-popdc1
Previous Names
  • MO1-bves
Target
Sequence
5' - GATGTTGTGTTGGACATTCTGAGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-popdc1
Expressed Gene Anatomy Figures
elnb Figure 4 with image from Shi et al., 2020
gata4 Figure 5 with image from Shi et al., 2020
hand2 Figure 5 with image from Shi et al., 2020
isl1a Figure 5 with image from Shi et al., 2020
mef2ca Figure 5 with image from Shi et al., 2020
nkx2.5 Figure 5 with image from Shi et al., 2020
popdc1 Fig. 2 from Wu et al., 2014
Fig. 7,  Fig. 8 from Wu et al., 2012
smyd1a Figure 5 with image from Shi et al., 2020
smyd1b Figure 5 with image from Shi et al., 2020
tbx1 Figure 5 with image from Shi et al., 2020
tbx20 Figure 5 with image from Shi et al., 2020
Phenotype
Phenotype resulting from MO1-popdc1
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
axis increased length, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
brain malformed, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
bulbus arteriosus elnb expression decreased amount, abnormal AB + MO1-popdc1 Figure 4 with image from Shi et al., 2020
bulbus arteriosus decreased size, abnormal AB + MO1-popdc1 Figure 4 with image from Shi et al., 2020
bulbus arteriosus decreased width, abnormal AB + MO1-popdc1 Figure 4 with image,  Figure 5 with image from Shi et al., 2020
determination of heart left/right asymmetry disrupted, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) Figure 3 with image from Shi et al., 2020
epidermal cell permeable, abnormal WT + MO1-popdc1 Fig. 5 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO1-popdc1 Fig. 3,  Fig. 5 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO1-popdc1 Fig. 5 from Wu et al., 2012
epidermis separated from muscle, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
extension decreased length, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
eye decreased size, abnormal WT + MO1-popdc1 Fig. 2 from Wu et al., 2014
eye photoreceptor cell immature, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2014
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2014
green sensitive photoreceptor cell absent, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2014
heart dysplastic, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) Figure 3 with image from Shi et al., 2020
heart edematous, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) Figure 3 with image from Shi et al., 2020
heart looping disrupted, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) Figure 3 with image from Shi et al., 2020
heart primordium increased size, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
lens decreased size, abnormal WT + MO1-popdc1 Fig. 2 from Wu et al., 2014
muscle malformed, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO1-popdc1 Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal WT + MO1-popdc1 Fig. 4 from Wu et al., 2014
pericardium edematous, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
red sensitive photoreceptor cell absent, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2014
retina neuron mislocalised, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2014
retina layer formation decreased process quality, abnormal WT + MO1-popdc1 Fig. 2,  Fig. 3 from Wu et al., 2014
retinal neural layer absent, abnormal WT + MO1-popdc1 Fig. 2,  Fig. 3 from Wu et al., 2014
retinal neural layer malformed, abnormal WT + MO1-popdc1 Fig. 2 from Wu et al., 2014
retinal pigmented epithelium detached from retina, abnormal WT + MO1-popdc1 Fig. 2 from Wu et al., 2014
somite shape, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
tail bud deformed, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
whole organism mef2ca expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism hand2 expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism gata4 expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism tbx20 expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism nkx2.5 expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism tbx1 expression decreased amount, abnormal AB + MO1-popdc1 Figure 5 with image from Shi et al., 2020
whole organism deformed, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
yolk protruding, abnormal WT + MO1-popdc1 Fig. 3 from Wu et al., 2012
Phenotype of all Fish created by or utilizing MO1-popdc1
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) standard conditions Figure 3 with image from Shi et al., 2020
determination of heart left/right asymmetry disrupted, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) standard conditions Figure 3 with image from Shi et al., 2020
heart dysplastic, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) standard conditions Figure 3 with image from Shi et al., 2020
heart edematous, abnormal pd15Tg/pd15Tg + MO1-popdc1 (AB) standard conditions Figure 3 with image from Shi et al., 2020
whole organism tbx1 expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
bulbus arteriosus decreased size, abnormal AB + MO1-popdc1 standard conditions Figure 4 with image from Shi et al., 2020
bulbus arteriosus elnb expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 4 with image from Shi et al., 2020
whole organism nkx2.5 expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
whole organism mef2ca expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
whole organism hand2 expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
heart looping disrupted, abnormal AB + MO1-popdc1 standard conditions Figure 3 with image from Shi et al., 2020
determination of heart left/right asymmetry disrupted, abnormal AB + MO1-popdc1 standard conditions Figure 3 with image from Shi et al., 2020
bulbus arteriosus decreased width, abnormal AB + MO1-popdc1 standard conditions Figure 4 with image from Shi et al., 2020
whole organism tbx20 expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
whole organism gata4 expression decreased amount, abnormal AB + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
somite shape, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO1-popdc1 standard conditions Fig. 5 from Wu et al., 2012
muscle malformed, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
red sensitive photoreceptor cell absent, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2014
retinal neural layer malformed, abnormal WT + MO1-popdc1 standard conditions Fig. 2 from Wu et al., 2014
retinal pigmented epithelium detached from retina, abnormal WT + MO1-popdc1 standard conditions Fig. 2 from Wu et al., 2014
retinal neural layer absent, abnormal WT + MO1-popdc1 standard conditions Fig. 2,  Fig. 3 from Wu et al., 2014
somitogenesis arrested, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
lens decreased size, abnormal WT + MO1-popdc1 standard conditions Fig. 2 from Wu et al., 2014
eye photoreceptor cell immature, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2014
immature eye decreased size, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
green sensitive photoreceptor cell absent, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2014
post-vent region decreased length, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
epidermal cell permeable, abnormal WT + MO1-popdc1 standard conditions Fig. 5 from Wu et al., 2012
pericardium edematous, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
retina neuron mislocalised, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2014
heart primordium increased size, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
brain malformed, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
extension decreased length, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
retina layer formation decreased process quality, abnormal WT + MO1-popdc1 standard conditions Fig. 2,  Fig. 3 from Wu et al., 2014
tail bud deformed, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO1-popdc1 standard conditions Fig. 3,  Fig. 5 from Wu et al., 2012
eye decreased size, abnormal WT + MO1-popdc1 standard conditions Fig. 2 from Wu et al., 2014
axis decreased length, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
epidermis separated from muscle, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
yolk protruding, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO1-popdc1 standard conditions Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal WT + MO1-popdc1 standard conditions Fig. 4 from Wu et al., 2014
whole organism hypotrophic, abnormal WT + MO1-popdc1 isotonic Fig. 5 from Wu et al., 2012
axis increased length, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2012
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-popdc1 standard conditions Fig. 3 from Wu et al., 2014
bulbus arteriosus decreased width, abnormal y1Tg + MO1-popdc1 standard conditions Figure 5 with image from Shi et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.