Morpholino

MO2-s1pr1

ID
ZDB-MRPHLNO-121026-2
Name
MO2-s1pr1
Previous Names
None
Target
Sequence
5' - AGTGTCTGGCGATTAGGTCATCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-s1pr1
No data available
Phenotype
Phenotype resulting from MO2-s1pr1
Phenotype Fish Figures
blood vessel development disrupted, abnormal y1Tg + MO2-s1pr1 Fig. 5 with imageFig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus decreased area, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus decreased length, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus decreased width, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 Fig. 6 with imageFig. 9 with image from Ben Shoham et al., 2012
caudal vein plexus endothelial cell has extra parts of type endothelial cell filopodium, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
dorsal aorta endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel disorganized, abnormal y1Tg + MO2-s1pr1 Fig. 5Fig. S1 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
endothelial cell migration delayed, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
filopodium assembly increased occurrence, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
heart morphology, abnormal twu34Tg + MO2-s1pr1 Fig. S1 with image from Guzzolino et al., 2018
heart physical object quality, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
heart looping decreased occurrence, abnormal twu34Tg + MO2-s1pr1 Fig. S1 with image from Guzzolino et al., 2018
heart looping disrupted, abnormal AB/TU + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
hindbrain malformed, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 Fig. 5Fig. S1 from Mendelson et al., 2013
intersegmental vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
nucleate erythrocyte increased accumulation blood island, abnormal sd2Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
pericardium edematous, abnormal AB/TU + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
Fig. 5 with image from Ben Shoham et al., 2012
posterior cardinal vein endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
regulation of blood vessel remodeling process quality, abnormal y1Tg + MO2-s1pr1 Fig. 6 with imageFig. 7 with image from Ben Shoham et al., 2012
retina filopodium increased amount, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
sprouting angiogenesis process quality, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
subintestinal vein deformed, abnormal y1Tg + MO2-s1pr1 Fig. S1 from Mendelson et al., 2013
subintestinal vein dilated, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
subintestinal vein has extra parts of type angiogenic sprout, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 Fig. 9 with image from Ben Shoham et al., 2012
Phenotype of all Fish created by or utilizing MO2-s1pr1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB/TU + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
heart looping disrupted, abnormal AB/TU + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
nucleate erythrocyte increased accumulation blood island, abnormal sd2Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
heart morphology, abnormal twu34Tg + MO2-s1pr1 standard conditions Fig. S1 with image from Guzzolino et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO2-s1pr1 standard conditions Fig. S1 with image from Guzzolino et al., 2018
subintestinal vein deformed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S1 from Mendelson et al., 2013
hindbrain malformed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
dorsal longitudinal anastomotic vessel disorganized, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5Fig. S1 from Mendelson et al., 2013
subintestinal vein dilated, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus decreased area, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
pericardium edematous, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5Fig. S1 from Mendelson et al., 2013
retina filopodium increased amount, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 9 with image from Ben Shoham et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
caudal vein plexus decreased width, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
endothelial cell migration delayed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
blood vessel development disrupted, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with imageFig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 chemical treatment: semaxanib Fig. 9 with image from Ben Shoham et al., 2012
sprouting angiogenesis process quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
caudal vein plexus endothelial cell has extra parts of type endothelial cell filopodium, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
heart physical object quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
regulation of blood vessel remodeling process quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 with imageFig. 7 with image from Ben Shoham et al., 2012
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 with imageFig. 9 with image from Ben Shoham et al., 2012
filopodium assembly increased occurrence, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 chemical treatment: semaxanib Fig. 9 with image from Ben Shoham et al., 2012
caudal vein plexus decreased length, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
subintestinal vein has extra parts of type angiogenic sprout, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
posterior cardinal vein endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
dorsal aorta endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
intersegmental vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
pectoral fin absent, exacerbated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin amount, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
intersegmental vessel shortened, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 + MO2-spns2 standard conditions Fig. 7 from Mendelson et al., 2013
vasculature development disrupted, abnormal y1Tg + MO2-s1pr1 + MO2-spns2 standard conditions Fig. 7 from Mendelson et al., 2013
Citations