Morpholino

MO2-s1pr1

ID
ZDB-MRPHLNO-121026-2
Name
MO2-s1pr1
Previous Names
None
Target
Sequence
5' - AGTGTCTGGCGATTAGGTCATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-s1pr1
No data available
Phenotype
Phenotype resulting from MO2-s1pr1
Phenotype Fish Figures
blood vessel development disrupted, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image,  Fig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus decreased area, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus decreased length, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus decreased width, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 Fig. 6 with image,  Fig. 9 with image from Ben Shoham et al., 2012
caudal vein plexus endothelial cell has extra parts of type endothelial cell filopodium, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
dorsal aorta endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel disorganized, abnormal y1Tg + MO2-s1pr1 Fig. 5,  Fig. S1 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
endothelial cell migration delayed, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
filopodium assembly increased occurrence, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
heart morphology, abnormal twu34Tg + MO2-s1pr1 Fig. S1 with image from Guzzolino et al., 2018
heart physical object quality, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
heart looping decreased occurrence, abnormal twu34Tg + MO2-s1pr1 Fig. S1 with image from Guzzolino et al., 2018
heart looping disrupted, abnormal AB/TU + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
hindbrain malformed, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO2-s1pr1 Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 Fig. 5,  Fig. S1 from Mendelson et al., 2013
intersegmental vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
nucleate erythrocyte increased accumulation blood island, abnormal sd2Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
pericardium edematous, abnormal y1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
Fig. 5 with image from Ben Shoham et al., 2012
posterior cardinal vein endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 Fig. 5 from Mendelson et al., 2013
regulation of blood vessel remodeling process quality, abnormal y1Tg + MO2-s1pr1 Fig. 6 with image,  Fig. 7 with image from Ben Shoham et al., 2012
retina filopodium increased amount, abnormal y1Tg + MO2-s1pr1 Fig. 6 from Mendelson et al., 2013
sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
sprouting angiogenesis process quality, abnormal y1Tg + MO2-s1pr1 Fig. 7 with image from Ben Shoham et al., 2012
subintestinal vein deformed, abnormal y1Tg + MO2-s1pr1 Fig. S1 from Mendelson et al., 2013
subintestinal vein dilated, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
subintestinal vein has extra parts of type angiogenic sprout, abnormal y1Tg + MO2-s1pr1 Fig. S2 with image from Ben Shoham et al., 2012
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 Fig. 9 with image from Ben Shoham et al., 2012
Phenotype of all Fish created by or utilizing MO2-s1pr1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB/TU + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
heart looping disrupted, abnormal AB/TU + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
nucleate erythrocyte increased accumulation blood island, abnormal sd2Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
heart morphology, abnormal twu34Tg + MO2-s1pr1 standard conditions Fig. S1 with image from Guzzolino et al., 2018
heart looping decreased occurrence, abnormal twu34Tg + MO2-s1pr1 standard conditions Fig. S1 with image from Guzzolino et al., 2018
subintestinal vein deformed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S1 from Mendelson et al., 2013
hindbrain malformed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
dorsal longitudinal anastomotic vessel disorganized, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5,  Fig. S1 from Mendelson et al., 2013
subintestinal vein dilated, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus decreased area, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
pericardium edematous, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5,  Fig. S1 from Mendelson et al., 2013
retina filopodium increased amount, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 9 with image from Ben Shoham et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
caudal vein plexus decreased width, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
endothelial cell migration delayed, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
blood vessel development disrupted, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image,  Fig. S2 with image from Ben Shoham et al., 2012
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 chemical treatment: semaxanib Fig. 9 with image from Ben Shoham et al., 2012
sprouting angiogenesis process quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
caudal vein plexus endothelial cell has extra parts of type endothelial cell filopodium, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
heart physical object quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 5 with image from Ben Shoham et al., 2012
regulation of blood vessel remodeling process quality, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 with image,  Fig. 7 with image from Ben Shoham et al., 2012
caudal vein plexus morphology, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 with image,  Fig. 9 with image from Ben Shoham et al., 2012
filopodium assembly increased occurrence, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 7 with image from Ben Shoham et al., 2012
subintestinal vein morphology, abnormal y1Tg + MO2-s1pr1 chemical treatment: semaxanib Fig. 9 with image from Ben Shoham et al., 2012
caudal vein plexus decreased length, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. 6 from Mendelson et al., 2013
subintestinal vein has extra parts of type angiogenic sprout, abnormal y1Tg + MO2-s1pr1 standard conditions Fig. S2 with image from Ben Shoham et al., 2012
posterior cardinal vein endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
dorsal aorta endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
intersegmental vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
dorsal longitudinal anastomotic vessel endothelial cell decreased amount, abnormal s896Tg; ubs1Tg + MO2-s1pr1 standard conditions Fig. 5 from Mendelson et al., 2013
pectoral fin absent, exacerbated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
pectoral fin amount, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
heart morphology, ameliorated twu34Tg + MO1-tbx5a + MO2-s1pr1 standard conditions Fig. 6 with image from Guzzolino et al., 2018
intersegmental vessel shortened, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
intersegmental vessel morphology, abnormal y1Tg + MO1-s1pr2 + MO2-s1pr1 standard conditions Fig. 7 from Mendelson et al., 2013
intersegmental vessel shortened, abnormal y1Tg + MO2-s1pr1 + MO2-spns2 standard conditions Fig. 7 from Mendelson et al., 2013
vasculature development disrupted, abnormal y1Tg + MO2-s1pr1 + MO2-spns2 standard conditions Fig. 7 from Mendelson et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.