Morpholino

MO2-hdac4

ID
ZDB-MRPHLNO-120905-4
Name
MO2-hdac4
Previous Names
  • exon-10 to intron-10 (1)
Target
Sequence
5' - AGAGCCACAGAGGAGCTGCTTTACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hdac4
Expressed Gene Anatomy Figures
hdac4 Fig. 2 with image from Delaurier et al., 2012
Phenotype
Phenotype resulting from MO2-hdac4
No data available
Phenotype of all Fish created by or utilizing MO2-hdac4
Phenotype Fish Conditions Figures
trabecula communis hypoplastic, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
head anterior-most region shortened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
cranial neural crest antero-ventral region lacks all parts of type cranial neural crest cell, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
head anterior-most region decreased size, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
head anterior-most region antero-posteriorly flattened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
trabecula cranii decreased length, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
ethmoid cartilage perforate, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image,  Fig. 3 with image from Delaurier et al., 2012
ethmoid cartilage hypoplastic, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image,  Fig. 6 with image from Delaurier et al., 2012
ethmoid cartilage deformed, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
ethmoid cartilage morphology, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 3 with image from Delaurier et al., 2012
trabecula communis deformed, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
ethmoid cartilage shortened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
palate cleft, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image,  Fig. 3 with image from Delaurier et al., 2012
ethmoid cartilage notched, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
ethmoid cartilage decreased width, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image,  Fig. 6 with image from Delaurier et al., 2012
cranial neural crest medial region has fewer parts of type cranial neural crest cell, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
neural crest cell migration disrupted, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
cranial neural crest morphology, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
ethmoid cartilage hypoplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage notched, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage perforate, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage decreased width, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula communis hypoplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage shortened, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula communis aplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula cranii decreased length, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.