Morpholino

MO1-socs1a

ID
ZDB-MRPHLNO-120524-9
Name
MO1-socs1a
Previous Names
  • MO1-socs1 (1)
Target
Sequence
5' - CCACTGAACTGTGCGCCACCATCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-socs1a
Expressed Gene Anatomy Figures
csf1ra Fig. 4 from O'Sullivan et al., 2011
gata1a Fig. 4 from O'Sullivan et al., 2011
ikzf1 Fig. 3,  Fig. 4 from O'Sullivan et al., 2011
lcp1 Fig. 4 from O'Sullivan et al., 2011
lyz Fig. 4 from O'Sullivan et al., 2011
mmp9 Fig. 4 from O'Sullivan et al., 2011
mpx Fig. 4 from O'Sullivan et al., 2011
rag1 Fig. 4 from O'Sullivan et al., 2011
spi1b Fig. 4 from O'Sullivan et al., 2011
Phenotype
Phenotype resulting from MO1-socs1a
Phenotype Fish Figures
blood island distended, abnormal WT + MO1-socs1a Fig. 3,  Fig. 5 from O'Sullivan et al., 2011
brain hemorrhagic, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
embryonic hemopoiesis disrupted, abnormal WT + MO1-socs1a Fig. 4 from O'Sullivan et al., 2011
eye hemorrhagic, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
hematopoietic stem cell increased amount, abnormal WT + MO1-socs1a Fig. 4 from O'Sullivan et al., 2011
leukocyte ratio nucleate erythrocyte, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
macrophage increased amount, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
monocyte increased amount, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
neutrophil increased amount, abnormal WT + MO1-socs1a Fig. 3,  Fig. 5 from O'Sullivan et al., 2011
nucleate erythrocyte morphology, abnormal WT + MO1-socs1a Fig. 3 from O'Sullivan et al., 2011
thymus decreased size, abnormal WT + MO1-socs1a Fig. 4 from O'Sullivan et al., 2011
Phenotype of all Fish created by or utilizing MO1-socs1a
Phenotype Fish Conditions Figures
nucleate erythrocyte morphology, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
thymus decreased size, abnormal WT + MO1-socs1a standard conditions Fig. 4 from O'Sullivan et al., 2011
neutrophil increased amount, abnormal WT + MO1-socs1a standard conditions Fig. 3,  Fig. 5 from O'Sullivan et al., 2011
monocyte increased amount, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
blood island distended, abnormal WT + MO1-socs1a standard conditions Fig. 3,  Fig. 5 from O'Sullivan et al., 2011
eye hemorrhagic, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
leukocyte ratio nucleate erythrocyte, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
embryonic hemopoiesis disrupted, abnormal WT + MO1-socs1a standard conditions Fig. 4 from O'Sullivan et al., 2011
hematopoietic stem cell increased amount, abnormal WT + MO1-socs1a standard conditions Fig. 4 from O'Sullivan et al., 2011
macrophage increased amount, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
brain hemorrhagic, abnormal WT + MO1-socs1a standard conditions Fig. 3 from O'Sullivan et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.