Morpholino

MO2-popdc2

ID
ZDB-MRPHLNO-120322-3
Name
MO2-popdc2
Previous Names
None
Target
Sequence
5' - GTTCAATTGTTTCTCACCTGCCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-popdc2
No data available
Phenotype
Phenotype resulting from MO2-popdc2
No data available
Phenotype of all Fish created by or utilizing MO2-popdc2
Phenotype Fish Conditions Figures
atrium orientation cardiac ventricle, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
slow muscle cell misaligned with slow muscle cell, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell variant shape, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
cardiac muscle cell myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
slow muscle cell undulate, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart looping process quality, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell decreased mass, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
slow muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
heart malformed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
cephalic musculature hypoplastic, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
cephalic musculature malformed, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
Citations